SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (SMARCA4) - 662 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.31142
gtgagctccctcttctatggtggtgcacccgtgcccttactccccatctcaagcttgggt  c.859+60

         .         .         .         .         .         .  g.31202
ccttgagatgagctttgtcagggagaaagggccgagggtggtcaggctgaactgcagcct  c.859+120

         .         .         .         .         .         .  g.31262
gtacttttcttgtggtggtccccgggtctcccctgtagccagtcagttcccaaaggctgt  c.859+180

         .         .         .         .         .         .  g.31322
cgttcatccctcctctgacagcttgtggccttcacccagtccctgagccctgtatatgta  c.859+240

         .         .         .         .         .         .  g.31382
attgctcagtaagtgctgcaggctcccatctgttgggctcaaagaggcagtgggactcat  c.859+300

         .         .         .   g.31413
tacccatcctcttggagcctgaggtttagcg  c.859+331

--------------------- middle of intron ---------------------
                  g.31414     .         .         .           g.31444
                  c.860-331  atgggcattgaggggcaaattgcttccactg  c.860-301

.         .         .         .         .         .           g.31504
gatttagttggcactaggaggagatgacaggaaatgctgccatagagccacagacagaac  c.860-241

.         .         .         .         .         .           g.31564
aaaaaggccttgggagcctggggctggccccagtggagggtgtgaaggacgagggtgagg  c.860-181

.         .         .         .         .         .           g.31624
ctgagatctggaggaggttggagcccaaggcaggtgtgaaggacacccctgggtgaaagg  c.860-121

.         .         .         .         .         .           g.31684
tgggagatgggcggggtctgcctgtccccagtgcctcaagcagctcagcagctttccatt  c.860-61

.         .         .         .         .         .           g.31744
tccagcccgggatgggccccagagctcaacatgacgccctggccccttgccttctcccag  c.860-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center