SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (SMARCA4) - 180 nt intron 12 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.47298
gtgagttgggccttgcattccagatgcagtggggatccaagtcctcggtgggccttgttc  c.1943+60

         .         .         .  g.47328
cagggaggtggcagccaggagcaattttac  c.1943+90

--------------------- middle of intron ---------------------
                   g.47329    .         .         .           g.47358
                   c.1944-90  ttctgtttgaattcccggcaggtttggtag  c.1944-61

.         .         .         .         .         .           g.47418
ggaaagtgaattctgctggctctgagcagatttgtatgaaagcccttacattttttctag  c.1944-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center