SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (SMARCA4) - 249 nt intron 26 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.77656
gtgagcccagcaccggccccgacccctccccagcgtgaatggtggacgcgtgagcggctt  c.3774+60

         .         .         .         .         .         .  g.77716
tcatttttgtttttttaccttttttgcactcttattttttttgcatccctttggagtaaa  c.3774+120

       g.77721
gggag  c.3774+125

--------------------- middle of intron ---------------------
                                            g.77722           g.77725
                                            c.3775-124  tgtg  c.3775-121

.         .         .         .         .         .           g.77785
ggctgaacggaaagaggatgagtacttgctttttctttgaagtggtttttttttctaaac  c.3775-61

.         .         .         .         .         .           g.77845
tgctggtgaaagacgccggattgacagccctggagactgaagtcctctatttatccacag  c.3775-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center