SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (SMARCA4) - 713 nt intron 28 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.78339
gtaagcgctgcaggctggatggggcagttcaggcatcccactctgctgccaccaggagca  c.3951+60

         .         .         .         .         .         .  g.78399
aagcagacgtcctagtgcccatggtggtatccctagcaggtcagggagccagggacagct  c.3951+120

         .         .         .         .         .         .  g.78459
cacagtgcagcccactcccacctccagactgacccgtcttccacccccagtctcctgagg  c.3951+180

         .         .         .         .         .         .  g.78519
atggcatcggagggcgagatgcacacccagccttctgcatgtgacccgagacctgcccca  c.3951+240

         .         .         .         .         .         .  g.78579
ccagctctgttttctaacgggctctccagggcttcatgcactccctttcagagggagttc  c.3951+300

         .         .         .         .         .         g.78636
gccctatccaaggccaagggactgaccaggccttcagtcgcagagcccccttgcccc  c.3951+357

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.78692
    tgggtgggaaacaggaaataagccacccaagcaggggccccttggcccgcaggcct  c.3952-301

.         .         .         .         .         .           g.78752
catgcctccaccaacgctgggccacgcagctgctgcccccctgctggggtctgcagccct  c.3952-241

.         .         .         .         .         .           g.78812
cttgtgcaaccttccatcttttcgagtttcctctgcctcctgaggcagagcctctagtca  c.3952-181

.         .         .         .         .         .           g.78872
gggtctgacggagccaggccaggtcagccactgaaaaatcgagagctactgtttaactct  c.3952-121

.         .         .         .         .         .           g.78932
cgcagcagcgtggagccccacgggcagagaaaggcccttctgaactctcggtgttctggc  c.3952-61

.         .         .         .         .         .           g.78992
tctagcgtgcccctggtgcctgcatgctgatgcctctcccgttgcctccctgcccaccag  c.3952-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center