SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (SMARCA4) - 424 nt intron 32 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.102502
gtaaccctgacgttgtacctgcgccccgcatgtgcccggaggggagtctgacccaggggc  c.4629+60

         .         .         .         .         .         .  g.102562
acccccatctgagagctgtggtgtgtgggcagaatgaccagaaaccacctaggcggtgcc  c.4629+120

         .         .         .         .         .         .  g.102622
ttgggctacctggttagggacctggtcgtgggcttttggggttccttgtaagggttgggg  c.4629+180

         .         .         .    g.102654
gtgtcctgagggatgtcagtgggcagtcggtg  c.4629+212

--------------------- middle of intron ---------------------
                g.102655      .         .         .           g.102686
                c.4630-212  ttgggtgttccttcaaggtcccactcacttag  c.4630-181

.         .         .         .         .         .           g.102746
tgctgggcctcagtcatgcagttcccatgcctagtgagccaggttaccgaggctggcgct  c.4630-121

.         .         .         .         .         .           g.102806
tcggccacatcctcataggcacgaggaatcctagcccgtggggtctccagcacacagcca  c.4630-61

.         .         .         .         .         .           g.102866
ggcctgcgggcaggcgaggcggggtcctgaggtaagacctgctcctcccgtccactgcag  c.4630-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center