SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (SMARCA4) - 159 nt intron 34 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.104024
gtgagtcccgggggggttcaggacgccggggttcacgctggcccgagagcccccaaggcc  c.4864+60

         .         .  g.104044
ccagcttttcacagccctcc  c.4864+80

--------------------- middle of intron ---------------------
                              g.104045            .           g.104063
                              c.4865-79  cggctcccagacgcccctt  c.4865-61

.         .         .         .         .         .           g.104123
gctgtgggggtgctgcattcccagagctcaaggctgtctttccctcccggtcccctccag  c.4865-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center