SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (SMARCA4) - 567 nt intron 17 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.63162
gtaggtcacagccactgaggtttcctctcttgctacggaggtgcaggcggtggtgggcag  c.2505+60

         .         .         .         .         .         .  g.63222
gacgtccacacatacctctggacagtgaacctgagaatgctgggtctccagtcgcatgga  c.2505+120

         .         .         .         .         .         .  g.63282
gtctccaggacagcctggaactccagtcacatggatccgggagtttggactgggcaggga  c.2505+180

         .         .         .         .         .         .  g.63342
cagggcagattagctcactggggaggagacaggagtgagcatggtggccagcactcagag  c.2505+240

         .         .         .         .      g.63386
gccagctcaggcgcctgagatggggacccaggaagaggggagcc  c.2505+284

--------------------- middle of intron ---------------------
     g.63387        .         .         .         .           g.63429
     c.2506-283  tgtcagccaccaggaatgtgcagatggcggtgcaggctgcgtg  c.2506-241

.         .         .         .         .         .           g.63489
gttccctcaggccccggccgccgctggcctgcactgcttcctcttccccctgcagcgcgt  c.2506-181

.         .         .         .         .         .           g.63549
gttctgcgtggtgaggtctggggacgcgccagcggccctgccagcccctttccccactac  c.2506-121

.         .         .         .         .         .           g.63609
ccctgtgaggacgagccctcccgccgtgtcactgggcagttgcagggggtgcctgtgccc  c.2506-61

.         .         .         .         .         .           g.63669
ctcttgccacctggccacccggctccaaaagccgagctgtgcatcctgcttcccttgcag  c.2506-1


Powered by LOVD v.3.0 Build 28
©2004-2022 Leiden University Medical Center