SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (SMARCA4) - 983 nt intron 21 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.68577
gtgggccccagagtcccccaactgcattccccactgggtgtccaaggccggcagcgtggc  c.3081+60

         .         .         .         .         .         .  g.68637
aggcagagcagagcgtgctctgaccatcgggtcatgatctggtcatgatccccagggcat  c.3081+120

         .         .         .         .         .         .  g.68697
ctggccagccctggttatgatggctggtggcttgtgtcaggacacactgactcagctgcc  c.3081+180

         .         .         .         .         .         .  g.68757
agtggcttctcctttgcctatgaaacactggctccttctgcaattggcagcctgggccca  c.3081+240

         .         .         .         .         .         .  g.68817
gcactaaccccagcagggttagagtgttctagaatgccccccttctctgttattaagtga  c.3081+300

         .         .         .         .         .         .  g.68877
aaggaagggagcgggctgtctcctgcaggggctgctctgagaatcccaggccccaggccc  c.3081+360

         .         .         .         .         .         .  g.68937
cacctgcctggctctcctcaccagcagtgaaattatcctcccaggaaatgcaccagaccc  c.3081+420

         .         .         .         .         .         .  g.68997
cttgattctgcccccaaggccttgacctcggcctggcttccccgagacgttgtgtctgtg  c.3081+480

         .    g.69009
ccccttctcccc  c.3081+492

--------------------- middle of intron ---------------------
                                     g.69010      .           g.69020
                                     c.3082-491  tgagctgagca  c.3082-481

.         .         .         .         .         .           g.69080
gcagtgtgttccctagtccattcccagcccagagcatgcaccccccgccccgcccccacc  c.3082-421

.         .         .         .         .         .           g.69140
tccttcctcatcctggagcccagggagccctgagtcatggctcacccggctgaggccctc  c.3082-361

.         .         .         .         .         .           g.69200
ttgcccagctgagaccctctagggacccccacagtaacagtgcccagaacaaagctggca  c.3082-301

.         .         .         .         .         .           g.69260
tcacaaagcatcggggactctgcctcagccctttgccagtcttgtttccgtcccgtcctg  c.3082-241

.         .         .         .         .         .           g.69320
ctggccctgtccctgccatctgccctctgctgtgccaggcagtcatttgtttcccagggc  c.3082-181

.         .         .         .         .         .           g.69380
ttgttgggggcctccgggcctccagcctgccatctcctcactcccaattgctgtgccaaa  c.3082-121

.         .         .         .         .         .           g.69440
agccactcttccccactagagcgtccccatggcccttctcccaacacccacccatccacc  c.3082-61

.         .         .         .         .         .           g.69500
aagcccaccccaccccaggagggcaagaccccatttgggtccctctcatctgccttccag  c.3082-1


Powered by LOVD v.3.0 Build 28
©2004-2022 Leiden University Medical Center