SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 (SMARCB1) - 437 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.51801
gtacccctggccctgtggtcctgggctctgcccacaggcacctggctttccaggcagagg  c.1118+60

         .         .         .         .         .         .  g.51861
cagggccattgcctttcccagtctcccatggtctctgagacagagtacctctagtgctgc  c.1118+120

         .         .         .         .         .         .  g.51921
tagaggcaggcaggcttctgggtgataaggccccatccaaacgccagggtatgtttccct  c.1118+180

         .         .         .           g.51960
gcatggaacaaacataattcctcaggctgagggtctgac  c.1118+219

--------------------- middle of intron ---------------------
          g.51961             .         .         .           g.51998
          c.1119-218  cacagcccagatccaggttttggggtccctggagtgat  c.1119-181

.         .         .         .         .         .           g.52058
gagcagggcctgagtggcagacaggcgaggctgagagaaggctgggtctgaccctgctgg  c.1119-121

.         .         .         .         .         .           g.52118
gggcccacatcctgcctctgttcccacccctacacttggctgccctgtagagccttggga  c.1119-61

.         .         .         .         .         .           g.52178
agggcagcgcccaggctgggagctggccccgactcattgccctccccactcctcttccag  c.1119-1


Powered by LOVD v.3.0 Build 13
©2004-2015 Leiden University Medical Center