SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 (SMARCC2) - 244 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.10453
gtgagacctgggttttcctgtccacttgagtggatggtttggactaggaggcagaggact  c.562+60

         .         .         .         .         .         .  g.10513
aagatcaccattcagtacctgggctcctcctcttctttcaatcttgaatcctcttaccac  c.562+120

    g.10515
ct  c.562+122

--------------------- middle of intron ---------------------
                                               g.10516        g.10517
                                               c.563-122  ta  c.563-121

.         .         .         .         .         .           g.10577
agttcctattaccaagtcccctgctacaacaggagagtgcattagttagggcttttgtac  c.563-61

.         .         .         .         .         .           g.10637
agtattttttttgtgtccccctttagcttatatctctcccttctcttcctctatccccag  c.563-1


Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center