SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 (SMARCC2) - 149 nt intron 12 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.15631
gtaagacaggagcctcttgggcacggcagtcagagccaagggaaggggagggctcagctg  c.1141+60

         .       g.15646
cccccttttcgctag  c.1141+75

--------------------- middle of intron ---------------------
                                   g.15647        .           g.15660
                                   c.1142-74  cctgatgggctttt  c.1142-61

.         .         .         .         .         .           g.15720
ggtagggctttcttgcccctcaggaggctccagccttacatcttggtttttctctttcag  c.1142-1


Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center