SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 (SMARCC2) - 246 nt intron 20 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.22949
gtaatgggggtgggtggttccacctggccttcttagtttgcttttgaagggctagttact  c.2092+60

         .         .         .         .         .         .  g.23009
cagactgtgaatcctctcaagtttggctgccctgctggccttgtctgtgcgggcctcagc  c.2092+120

     g.23012
tca  c.2092+123

--------------------- middle of intron ---------------------
                                             g.23013          g.23015
                                             c.2093-123  ggc  c.2093-121

.         .         .         .         .         .           g.23075
acctgtctaggctccatactagcttagatgaagacatgggcttgtgagtaagcttttgca  c.2093-61

.         .         .         .         .         .           g.23135
gggattgccagaactgttccactgtgccgctcccagcctcattctttctgggtcttgcag  c.2093-1


Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center