SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2 (SMARCC2) - 232 nt intron 22 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.24484
gtatagagggatttctggaagctgcaggggctgcgtgcagcactgtggtgatggggaagt  c.2319+60

         .         .         .         .         .        g.24540
tggccttgttcagcttaggtgggcaagggctggttttggacggggttgtctcctag  c.2319+116

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.24596
    aatcagatcacctccaaagtaagaggaataaatttagttccccgtctggcccctct  c.2320-61

.         .         .         .         .         .           g.24656
gtgtgagaactaatcaccctaatccctgataactctccttttctatcactggaatttcag  c.2320-1


Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center