SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1 (SMARCD1) - 131 nt intron 12 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.18676
gtaagtacatggggtgcacgggggaaattgacaaaaggcacggggttttcacccctgatg  c.1494+60

        g.18682
ggggtc  c.1494+66

--------------------- middle of intron ---------------------
                                            g.18683           g.18687
                                            c.1495-65  agtgg  c.1495-61

.         .         .         .         .         .           g.18747
tgttagataccaacttctggtttgtctcatcttccactcccttcactattttctccttag  c.1495-1


Powered by LOVD v.3.0 Build 21c
©2004-2019 Leiden University Medical Center