small muscle protein, X-linked (SMPX) - coding DNA reference sequence

(used for variant description)

(last modified October 17, 2016)


This file was created to facilitate the description of sequence variants on transcript NM_014332.1 in the SMPX gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_031916.1, covering SMPX transcript NM_014332.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5003
                                                          gtt       c.-181

 .         .         .         .         .         .                g.5063
 ctcaataccgggagaggcacagagctatttcagccacatgaaaagcatcggaattgagat       c.-121

 .         .         .         .         .         .                g.5123
 cgcagctcagaggacaccgggcgccccttccaccttccaaggagctttgtattcttgcat       c.-61

 .         .         .         .         .        | 02.             g.8822
 ctggctgcctgggacttcccttaggcagtaaacaaatacataaagcag | ggataagactgc    c.-1

          .         .         .         .      | 03  .         .    g.19291
 ATGAATATGTCGAAACAGCCAGTTTCCAATGTTAGAGCCATCCAG | GCAAATATCAATATT    c.60
 M  N  M  S  K  Q  P  V  S  N  V  R  A  I  Q   | A  N  I  N  I      p.20

          .         .         .         .         .         .       g.19351
 CCAATGGGAGCCTTTCGGCCAGGAGCAGGTCAACCCCCCAGAAGAAAAGAATGTACTCCT       c.120
 P  M  G  A  F  R  P  G  A  G  Q  P  P  R  R  K  E  C  T  P         p.40

          .   | 04     .         .         .         .         .    g.25463
 GAAGTGGAGGAG | GGTGTTCCTCCCACCTCGGATGAGGAGAAGAAGCCAATTCCAGGAGCG    c.180
 E  V  E  E   | G  V  P  P  T  S  D  E  E  K  K  P  I  P  G  A      p.60

          .         .         .         .         .         .       g.25523
 AAGAAACTTCCAGGACCTGCAGTCAATCTATCGGAAATCCAGAATATTAAAAGTGAACTA       c.240
 K  K  L  P  G  P  A  V  N  L  S  E  I  Q  N  I  K  S  E  L         p.80

          .         .                                           g.25550
 AAATATGTCCCCAAAGCTGAACAGTAG |                                     c.268
 K  Y  V  P  K  A  E  Q  X                                       p.88

          .     | 05   .         .         .         .         .    g.56764
 taggaagaaaaaag | gattgatgtgaagaaataaagaggcagaagatggattcaatagctc    c.*60

          .         .         .         .         .         .       g.56824
 actaaaattttatatatttgtatgatgattgtgaacctcctgaatgcctgagactctagc       c.*120

          .         .         .         .         .         .       g.56884
 agaaatggcctgtttgtacatttatatctcttccttctagttggctgtatttcttacttt       c.*180

          .         .         .         .         .         .       g.56944
 atcttcatttttggcacctcacagaacaaattagcccataaattcaacacctggagggtg       c.*240

          .         .         .         .         .         .       g.57004
 tggttttgaggagggatatgattttatggagaatgatatggcaatgtgcctaacgatttt       c.*300

          .         .         .         .         .         .       g.57064
 gatgaaaagtttcccaagctacttcctacagtattttggtcaatatttggaatgcgtttt       c.*360

          .         .         .         .         .         .       g.57124
 agttcttcaccttttaaattatgtcactaaactttgtatgagttcaaataaatatttgac       c.*420

          .                                                         g.57140
 taaatgtaaaatgtga                                                   c.*436

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Small muscle protein, X-linked protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 17
©2004-2016 Leiden University Medical Center