SNAP-associated protein (SNAPIN) - coding DNA reference sequence

(used for variant description)

(last modified October 13, 2025)

This file was created to facilitate the description of sequence variants on transcript NM_012437.5 in the SNAPIN gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000001.10, covering SNAPIN transcript NM_012437.5.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5030
                               cgggcgccccctcacggggcggggcagtgc       c.-61

 .         .         .         .         .         .                g.5090
 ggcgcggctccggttcccggcggccctcgcggcaggtttcgggcttcaggacaattcgtg       c.-1

          .         .         .         .         .         .       g.5150
 ATGGCGGGGGCTGGTTCCGCCGCTGTATCGGGGGCAGGGACCCCGGTGGCGGGGCCCACA       c.60
 M  A  G  A  G  S  A  A  V  S  G  A  G  T  P  V  A  G  P  T         p.20

          .         .         .         .         .         .       g.5210
 GGCCGCGACCTTTTCGCCGAAGGGCTGCTGGAGTTCCTGCGACCCGCTGTGCAGCAGCTC       c.120
 G  R  D  L  F  A  E  G  L  L  E  F  L  R  P  A  V  Q  Q  L         p.40

          .         .    | 02    .         .         .         .    g.5521
 GACTCTCACGTACACGCCGTCAG | AGAGAGCCAGGTAGAGCTCCGGGAACAAATTGACAAC    c.180
 D  S  H  V  H  A  V  R  |  E  S  Q  V  E  L  R  E  Q  I  D  N      p.60

          . | 03       .         .         .         .         .    g.5844
 CTAGCCACAG | AACTGTGCCGCATAAATGAGGATCAGAAGGTGGCCCTGGATCTTGACCCC    c.240
 L  A  T  E |   L  C  R  I  N  E  D  Q  K  V  A  L  D  L  D  P      p.80

          .         .         .         .         .         .       g.5904
 TATGTTAAGAAGCTACTTAATGCCCGGCGACGCGTTGTCTTGGTTAACAACATTCTACAG       c.300
 Y  V  K  K  L  L  N  A  R  R  R  V  V  L  V  N  N  I  L  Q         p.100

           | 04        .         .         .         .         .    g.7597
 AATGCTCAG | GAACGACTGAGACGGCTAAACCACAGTGTTGCCAAGGAAACAGCCCGCAGG    c.360
 N  A  Q   | E  R  L  R  R  L  N  H  S  V  A  K  E  T  A  R  R      p.120

          .         .         .         .         .                 g.7648
 AGAGCAATGCTGGATTCGGGAATTTACCCCCCTGGCTCCCCAGGCAAATAA                c.411
 R  A  M  L  D  S  G  I  Y  P  P  G  S  P  G  K  X                  p.136

          .         .         .         .         .         .       g.7708
 cagatgagcctatggactcagtagcacaagtactgttccccagctgccttgtttcaacag       c.*60

          .         .         .         .         .         .       g.7768
 acatgcaaagatcctaggagacagtccccatagaccttcagacattaaaaagggagccgt       c.*120

          .         .         .         .         .         .       g.7828
 acagtttgtttgaagcacttcgtcttacccatttatgtaggggccccaggaaacctacac       c.*180

          .         .         .         .         .         .       g.7888
 acagccagaatgaggttcccaaaggacttacattaattatggctcttgcttcctttcaca       c.*240

          .         .         .         .         .         .       g.7948
 aatgagctgaggcctctacttttttttttaagctgcatacgtgaggcttaccttcttcag       c.*300

          .         .         .         .         .         .       g.8008
 gactagttaaccagaggggcttcctttgtatgttacatgcctggttacatgggcctggac       c.*360

          .         .         .         .         .         .       g.8068
 agcatgtcctctacctgtgacttctcattttcctgtttacactggggatttggagggggc       c.*420

          .         .         .         .         .         .       g.8128
 aggcaaagtcaaagtgaatgacctctgtccacccacttttttattgcactggcttgaata       c.*480

          .         .         .         .         .         .       g.8188
 cagtagcagtgttgatagaatcattttattcaataaatacttaaaatgatattctagttt       c.*540

          .                                                         g.8199
 actctggtata                                                        c.*551

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The SNAP-associated protein protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.