superoxide dismutase 1, soluble (SOD1) - coding DNA reference sequence

(used for variant description)

(last modified July 19, 2016)

This file was created to facilitate the description of sequence variants on transcript NM_000454.4 in the SOD1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008689.1, covering SOD1 transcript NM_000454.4.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5028
                                 gtttggggccagagtgggcgaggcgcgg       c.-121

 .         .         .         .         .         .                g.5088
 aggtctggcctataaagtagtcgcggagacggggtgctggtttgcgtcgtagtctcctgc       c.-61

 .         .         .         .         .         .                g.5148
 agcgtctggggtttccgttgcagtcctcggaaccaggacctcggcgtggcctagcgagtt       c.-1

          .         .         .         .         .         .       g.5208
 ATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCATCAAT       c.60
 M  A  T  K  A  V  C  V  L  K  G  D  G  P  V  Q  G  I  I  N         p.20

          .   | 02     .         .         .         .         .    g.9216
 TTCGAGCAGAAG | GAAAGTAATGGACCAGTGAAGGTGTGGGGAAGCATTAAAGGACTGACT    c.120
 F  E  Q  K   | E  S  N  G  P  V  K  V  W  G  S  I  K  G  L  T      p.40

          .         .         .         .          | 03        .    g.11838
 GAAGGCCTGCATGGATTCCATGTTCATGAGTTTGGAGATAATACAGCAG | GCTGTACCAGT    c.180
 E  G  L  H  G  F  H  V  H  E  F  G  D  N  T  A  G |   C  T  S      p.60

          .         .         .         .         .          | 04    g.12637
 GCAGGTCCTCACTTTAATCCTCTATCCAGAAAACACGGTGGGCCAAAGGATGAAGAGAG | G    c.240
 A  G  P  H  F  N  P  L  S  R  K  H  G  G  P  K  D  E  E  R  |      p.80

          .         .         .         .         .         .       g.12697
 CATGTTGGAGACTTGGGCAATGTGACTGCTGACAAAGATGGTGTGGCCGATGTGTCTATT       c.300
 H  V  G  D  L  G  N  V  T  A  D  K  D  G  V  A  D  V  S  I         p.100

          .         .         .         .         .        | 05.    g.13852
 GAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTGGCCGCACACTGGTG | GTC    c.360
 E  D  S  V  I  S  L  S  G  D  H  C  I  I  G  R  T  L  V   | V      p.120

          .         .         .         .         .         .       g.13912
 CATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGACAGGAAAC       c.420
 H  E  K  A  D  D  L  G  K  G  G  N  E  E  S  T  K  T  G  N         p.140

          .         .         .         .                           g.13957
 GCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAA                      c.465
 A  G  S  R  L  A  C  G  V  I  G  I  A  Q  X                        p.154

          .         .         .         .         .         .       g.14017
 acattcccttggatgtagtctgaggccccttaactcatctgttatcctgctagctgtaga       c.*60

          .         .         .         .         .         .       g.14077
 aatgtatcctgataaacattaaacactgtaatcttaaaagtgtaattgtgtgactttttc       c.*120

          .         .         .         .         .         .       g.14137
 agagttgctttaaagtacctgtagtgagaaactgatttatgatcacttggaagatttgta       c.*180

          .         .         .         .         .         .       g.14197
 tagttttataaaactcagttaaaatgtctgtttcaatgacctgtattttgccagacttaa       c.*240

          .         .         .         .         .         .       g.14257
 atcacagatgggtattaaacttgtcagaatttctttgtcattcaagcctgtgaataaaaa       c.*300

          .         .         .         .         .                 g.14310
 ccctgtatggcacttattatgaggctattaaaagaatccaaattcaaactaaa              c.*353

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Superoxide dismutase 1, soluble protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.