superoxide dismutase 2, mitochondrial (SOD2) - coding DNA reference sequence

(used for variant description)

(last modified December 23, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_000636.2 in the SOD2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008729.3, covering SOD2 transcript NM_000636.2.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                               .         .         .                g.5034
                           gcggtgcccttgcggcgcagctggggtcgcggcc       c.-121

 .         .         .         .         .         .                g.5094
 ctgctccccgcgctttcttaaggcccgcgggcggcgcaggagcggcactcgtggctgtgg       c.-61

 .         .         .         .         .         .                g.5154
 tggcttcggcagcggcttcagcagatcggcggcatcagcggtagcaccagcactagcagc       c.-1

          .         .    | 02    .         .         .         .    g.5495
 ATGTTGAGCCGGGCAGTGTGCGG | CACCAGCAGGCAGCTGGCTCCGGTTTTGGGGTATCTG    c.60
 M  L  S  R  A  V  C  G  |  T  S  R  Q  L  A  P  V  L  G  Y  L      p.20

          .         .         .         .         .         .       g.5555
 GGCTCCAGGCAGAAGCACAGCCTCCCCGACCTGCCCTACGACTACGGCGCCCTGGAACCT       c.120
 G  S  R  Q  K  H  S  L  P  D  L  P  Y  D  Y  G  A  L  E  P         p.40

          .         .         .         .         .         .       g.5615
 CACATCAACGCGCAGATCATGCAGCTGCACCACAGCAAGCACCACGCGGCCTACGTGAAC       c.180
 H  I  N  A  Q  I  M  Q  L  H  H  S  K  H  H  A  A  Y  V  N         p.60

          .         .         .         .       | 03 .         .    g.10093
 AACCTGAACGTCACCGAGGAGAAGTACCAGGAGGCGTTGGCCAAGG | GAGATGTTACAGCC    c.240
 N  L  N  V  T  E  E  K  Y  Q  E  A  L  A  K  G |   D  V  T  A      p.80

          .         .         .         .         .         .       g.10153
 CAGATAGCTCTTCAGCCTGCACTGAAGTTCAATGGTGGTGGTCATATCAATCATAGCATT       c.300
 Q  I  A  L  Q  P  A  L  K  F  N  G  G  G  H  I  N  H  S  I         p.100

          .         .         .         .    | 04    .         .    g.13305
 TTCTGGACAAACCTCAGCCCTAACGGTGGTGGAGAACCCAAAG | GGGAGTTGCTGGAAGCC    c.360
 F  W  T  N  L  S  P  N  G  G  G  E  P  K  G |   E  L  L  E  A      p.120

          .         .         .         .         .         .       g.13365
 ATCAAACGTGACTTTGGTTCCTTTGACAAGTTTAAGGAGAAGCTGACGGCTGCATCTGTT       c.420
 I  K  R  D  F  G  S  F  D  K  F  K  E  K  L  T  A  A  S  V         p.140

          .         .         .         .         .         .       g.13425
 GGTGTCCAAGGCTCAGGTTGGGGTTGGCTTGGTTTCAATAAGGAACGGGGACACTTACAA       c.480
 G  V  Q  G  S  G  W  G  W  L  G  F  N  K  E  R  G  H  L  Q         p.160

          .         .         .         .    | 05    .         .    g.15700
 ATTGCTGCTTGTCCAAATCAGGATCCACTGCAAGGAACAACAG | GCCTTATTCCACTGCTG    c.540
 I  A  A  C  P  N  Q  D  P  L  Q  G  T  T  G |   L  I  P  L  L      p.180

          .         .         .         .         .         .       g.15760
 GGGATTGATGTGTGGGAGCACGCTTACTACCTTCAGTATAAAAATGTCAGGCCTGATTAT       c.600
 G  I  D  V  W  E  H  A  Y  Y  L  Q  Y  K  N  V  R  P  D  Y         p.200

          .         .         .         .         .         .       g.15820
 CTAAAAGCTATTTGGAATGTAATCAACTGGGAGAATGTAACTGAAAGATACATGGCTTGC       c.660
 L  K  A  I  W  N  V  I  N  W  E  N  V  T  E  R  Y  M  A  C         p.220

                                                                    g.15829
 AAAAAGTAA                                                          c.669
 K  K  X                                                            p.222

          .         .         .         .         .         .       g.15889
 accacgatcgttatgctgagtatgttaagctctttatgactgtttttgtagtggtataga       c.*60

          .         .         .         .         .         .       g.15949
 gtactgcagaatacagtaagctgctctattgtagcatttcttgatgttgcttagtcactt       c.*120

          .         .         .         .         .         .       g.16009
 atttcataaacaacttaatgttctgaataatttcttactaaacattttgttattgggcaa       c.*180

          .         .         .         .         .         .       g.16069
 gtgattgaaaatagtaaatgctttgtgtgattgaatctgattggacattttcttcagaga       c.*240

          .         .         .         .         .         .       g.16129
 gctaaattacaattgtcatttataaaaccatcaaaaatattccatccatatactttgggg       c.*300

          .         .         .         .         .         .       g.16189
 acttgtagggatgcctttctagtcctattctattgcagttatagaaaatctagtcttttg       c.*360

          .         .         .         .         .         .       g.16249
 ccccagttacttaaaaataaaatattaacactttcccaagggaaacactcggctttctat       c.*420

          .         .         .         .         .         .       g.16309
 agaaaattgcactttttgtcgagtaatcctctgcagtgatacttctggtagatgtcaccc       c.*480

          .         .         .         .         .         .       g.16369
 agtggtttttgttaggtcaaatgttcctgtatagtttttgcaaatagagctgtatactgt       c.*540

          .         .         .         .         .         .       g.16429
 ttaaatgtagcaggtgaactgaactggggtttgctcacctgcacagtaaaggcaaacttc       c.*600

          .         .         .         .         .         .       g.16489
 aacagcaaaactgcaaaaaggtggtttttgcagtaggagaaaggaggatgtttatttgca       c.*660

          .         .         .         .         .         .       g.16549
 gggcgccaagcaaggagaattgggcagctcatgcttgagacccaatctccatgatgacct       c.*720

          .         .         .         .         .                 g.16599
 acaagctagagtatttaaaggcagtggtaaatttcaggaaagcagaagtt                 c.*770

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Superoxide dismutase 2, mitochondrial protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 22
©2004-2019 Leiden University Medical Center