spermatogenesis and oogenesis specific basic helix-loop-helix 1 (SOHLH1) - 518 nt intron 02 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5594
gtgagtggtggtgcctcccaggggtgagggcgctgtaaaggggtggagcgggtgagatta  c.197+60

         .         .         .         .         .         .  g.5654
tgttcggggctgccaccaggtgtcaggcagctgggaggggctcgtggcctgtgcccagga  c.197+120

         .         .         .         .         .         .  g.5714
gaaggacagactgcacatctccaagtaaaccagaaaagccctgttggggaacatcctgca  c.197+180

         .         .         .         .         .         .  g.5774
gcccctctttatcctgaagccttggcctcttgaggctgtgcacctgtgaccctctgtgct  c.197+240

         .           g.5793
tctgactgcctctgaccct  c.197+259

--------------------- middle of intron ---------------------
                              g.5794              .           g.5812
                              c.198-259  cgctgtcttttccacaccg  c.198-241

.         .         .         .         .         .           g.5872
caaagcagccatggtttgggcctgggctggacagcctgtcgccgaggtccaggggtcagg  c.198-181

.         .         .         .         .         .           g.5932
cccaggctgtgctctgatgtggatctcggggcttcagaccacgggggcagctctgagtca  c.198-121

.         .         .         .         .         .           g.5992
tcttgtagccccctctgcctgacaagcgcccagggtctatctggcaggttctagcagttg  c.198-61

.         .         .         .         .         .           g.6052
ctgtcccttctcggggagggcaggagggcccagaggtatttgtttcttgaccggaaccag  c.198-1


Powered by LOVD v.3.0 Build 24c
©2004-2020 Leiden University Medical Center