spermatogenesis and oogenesis specific basic helix-loop-helix 1 (SOHLH1) - 700 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.7083
gttagtgtctcctggggcccgctctccagggctgggtgaccctgggagcagcagacccaa  c.467+60

         .         .         .         .         .         .  g.7143
agccccctggcatgtcctcgggagggtgtggcctggaggcccggcttggcctccgcaggt  c.467+120

         .         .         .         .         .         .  g.7203
ggtgacctgcccagggccctgccaactcaggtggccaggtgtgaggtgaccaacatgggc  c.467+180

         .         .         .         .         .         .  g.7263
gagctccagcaaggggggagcgcggtcagcagaattgagggcctgggctggtgtggaggt  c.467+240

         .         .         .         .         .         .  g.7323
gggaggtgcccgggaggatctcttctgctcctgtgtgtggggaatttacaggtggtcagt  c.467+300

         .         .         .         .         .  g.7373
gaggtgtcatactcctccccatgggcagcttcaggaatgcagttttctga  c.467+350

--------------------- middle of intron ---------------------
         g.7374     .         .         .         .         .           g.7423
         c.468-350  agtcaagataatttggttcttttcagaatggcagctccccaggttgaagg  c.468-301

.         .         .         .         .         .           g.7483
actgtctgcatcttgtgtttaaatgtacccattttaccccaaagcaggctggggcatggg  c.468-241

.         .         .         .         .         .           g.7543
actggtggctaattagctgtggaagaatctagaaccggaggagttgggcagagggaaact  c.468-181

.         .         .         .         .         .           g.7603
gggtagacagctgtggagcttggctggcccagggcccctgggcagaggctggcttgatgc  c.468-121

.         .         .         .         .         .           g.7663
tgggtggtgcctggggtgtcctggggatgggtccagccctctgctcttggggtgggtggg  c.468-61

.         .         .         .         .         .           g.7723
ggcagccttccagggggctggggaatagacccaggatccttgtcatgttgctccttctag  c.468-1


Powered by LOVD v.3.0 Build 24c
©2004-2020 Leiden University Medical Center