spermatogenesis and oogenesis specific basic helix-loop-helix 1 (SOHLH1) - 592 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)

         .         .         .         .         .         .  g.9539
gtgagtgcccaggtggtgtgcacgcctgtgtgtgcgtgagcgagcatgtgtgtgtgagcc  c.875+60

         .         .         .         .         .         .  g.9599
tgtcccacctcctcccagtcctgcttgggcccactttctcggcatctggaagcttccgtc  c.875+120

         .         .         .         .         .         .  g.9659
tctgcttctgtgcccgtgggagggaggccaaggccacagcccaggacaggaccagccagc  c.875+180

         .         .         .         .         .         .  g.9719
cttgccgtgtggctttctaatgtgtgtttctggaaacacttttgtcttcctaattgtcat  c.875+240

         .         .         .         .         .        g.9775
ttgttttggctgatagtaaaatgagtttgtgtttcgtgagcacataccagctgggg  c.875+296

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.9831
    tgtgggagggggaggggagggggagggaggggacgagaagagcgagactgtggctg  c.876-241

.         .         .         .         .         .           g.9891
gagagaaaccggcagagatgctctgcaggacggatcgggacccgcgagagccgctggccc  c.876-181

.         .         .         .         .         .           g.9951
gtgtcctcagcggctgtggcctctgcatttctccccgctgggcagggtggagcctgtcag  c.876-121

.         .         .         .         .         .           g.10011
gagtggtgcctagatctttgcattcgaagctgcctttgcaggacttgggcccaaatgttt  c.876-61

.         .         .         .         .         .           g.10071
ccttgagctccaaggtctgggtccgcttgtggccactgaggaagagcttgtcgcttccag  c.876-1