sclerostin (SOST) - coding DNA reference sequence

(used for variant description)

(last modified July 17, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_025237.2 in the SOST gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008078.2, covering SOST transcript NM_025237.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                     .         .         .         .                g.5047
              agagcctgtgctactggaaggtggcgtgccctcctctggctggtacc       c.-1

          .         .         .         .         .         .       g.5107
 ATGCAGCTCCCACTGGCCCTGTGTCTCGTCTGCCTGCTGGTACACACAGCCTTCCGTGTA       c.60
 M  Q  L  P  L  A  L  C  L  V  C  L  L  V  H  T  A  F  R  V         p.20

          .         .         .         .         .         .       g.5167
 GTGGAGGGCCAGGGGTGGCAGGCGTTCAAGAATGATGCCACGGAAATCATCCCCGAGCTC       c.120
 V  E  G  Q  G  W  Q  A  F  K  N  D  A  T  E  I  I  P  E  L         p.40

          .         .         .         .         .         .       g.5227
 GGAGAGTACCCCGAGCCTCCACCGGAGCTGGAGAACAACAAGACCATGAACCGGGCGGAG       c.180
 G  E  Y  P  E  P  P  P  E  L  E  N  N  K  T  M  N  R  A  E         p.60

          .         .         .         . | 02       .         .    g.8045
 AACGGAGGGCGGCCTCCCCACCACCCCTTTGAGACCAAAG | ACGTGTCCGAGTACAGCTGC    c.240
 N  G  G  R  P  P  H  H  P  F  E  T  K  D |   V  S  E  Y  S  C      p.80

          .         .         .         .         .         .       g.8105
 CGCGAGCTGCACTTCACCCGCTACGTGACCGATGGGCCGTGCCGCAGCGCCAAGCCGGTC       c.300
 R  E  L  H  F  T  R  Y  V  T  D  G  P  C  R  S  A  K  P  V         p.100

          .         .         .         .         .         .       g.8165
 ACCGAGCTGGTGTGCTCCGGCCAGTGCGGCCCGGCGCGCCTGCTGCCCAACGCCATCGGC       c.360
 T  E  L  V  C  S  G  Q  C  G  P  A  R  L  L  P  N  A  I  G         p.120

          .         .         .         .         .         .       g.8225
 CGCGGCAAGTGGTGGCGACCTAGTGGGCCCGACTTCCGCTGCATCCCCGACCGCTACCGC       c.420
 R  G  K  W  W  R  P  S  G  P  D  F  R  C  I  P  D  R  Y  R         p.140

          .         .         .         .         .         .       g.8285
 GCGCAGCGCGTGCAGCTGCTGTGTCCCGGTGGTGAGGCGCCGCGCGCGCGCAAGGTGCGC       c.480
 A  Q  R  V  Q  L  L  C  P  G  G  E  A  P  R  A  R  K  V  R         p.160

          .         .         .         .         .         .       g.8345
 CTGGTGGCCTCGTGCAAGTGCAAGCGCCTCACCCGCTTCCACAACCAGTCGGAGCTCAAG       c.540
 L  V  A  S  C  K  C  K  R  L  T  R  F  H  N  Q  S  E  L  K         p.180

          .         .         .         .         .         .       g.8405
 GACTTCGGGACCGAGGCCGCTCGGCCGCAGAAGGGCCGGAAGCCGCGGCCCCGCGCCCGG       c.600
 D  F  G  T  E  A  A  R  P  Q  K  G  R  K  P  R  P  R  A  R         p.200

          .         .         .         .                           g.8447
 AGCGCCAAAGCCAACCAGGCCGAGCTGGAGAACGCCTACTAG                         c.642
 S  A  K  A  N  Q  A  E  L  E  N  A  Y  X                           p.213

          .         .         .         .         .         .       g.8507
 agcccgcccgcgcccctccccaccggcgggcgccccggccctgaacccgcgccccacatt       c.*60

          .         .         .         .         .         .       g.8567
 tctgtcctctgcgcgtggtttgattgtttatatttcattgtaaatgcctgcaacccaggg       c.*120

          .         .         .         .         .         .       g.8627
 cagggggctgagaccttccaggccctgaggaatcccgggcgccggcaaggcccccctcag       c.*180

          .         .         .         .         .         .       g.8687
 cccgccagctgaggggtcccacggggcaggggagggaattgagagtcacagacactgagc       c.*240

          .         .         .         .         .         .       g.8747
 cacgcagccccgcctctggggccgcctacctttgctggtcccacttcagaggaggcagaa       c.*300

          .         .         .         .         .         .       g.8807
 atggaagcattttcaccgccctggggttttaagggagcggtgtgggagtgggaaagtcca       c.*360

          .         .         .         .         .         .       g.8867
 gggactggttaagaaagttggataagattcccccttgcacctcgctgcccatcagaaagc       c.*420

          .         .         .         .         .         .       g.8927
 ctgaggcgtgcccagagcacaagactgggggcaactgtagatgtggtttctagtcctggc       c.*480

          .         .         .         .         .         .       g.8987
 tctgccactaacttgctgtgtaaccttgaactacacaattctccttcgggacctcaattt       c.*540

          .         .         .         .         .         .       g.9047
 ccactttgtaaaatgagggtggaggtgggaataggatctcgaggagactattggcatatg       c.*600

          .         .         .         .         .         .       g.9107
 attccaaggactccagtgccttttgaatgggcagaggtgagagagagagagagaaagaga       c.*660

          .         .         .         .         .         .       g.9167
 gagaatgaatgcagttgcattgattcagtgccaaggtcacttccagaattcagagttgtg       c.*720

          .         .         .         .         .         .       g.9227
 atgctctcttctgacagccaaagatgaaaaacaaacagaaaaaaaaaagtaaagagtcta       c.*780

          .         .         .         .         .         .       g.9287
 tttatggctgacatatttacggctgacaaactcctggaagaagctatgctgcttcccagc       c.*840

          .         .         .         .         .         .       g.9347
 ctggcttccccggatgtttggctacctccacccctccatctcaaagaaataacatcatcc       c.*900

          .         .         .         .         .         .       g.9407
 attggggtagaaaaggagagggtccgagggtggtgggagggatagaaatcacatccgccc       c.*960

          .         .         .         .         .         .       g.9467
 caacttcccaaagagcagcatccctcccccgacccatagccatgttttaaagtcaccttc       c.*1020

          .         .         .         .         .         .       g.9527
 cgaagagaagtgaaaggttcaaggacactggccttgcaggcccgagggagcagccatcac       c.*1080

          .         .         .         .         .         .       g.9587
 aaactcacagaccagcacatcccttttgagacaccgccttctgcccaccactcacggaca       c.*1140

          .         .         .         .         .         .       g.9647
 catttctgcctagaaaacagcttcttactgctcttacatgtgatggcatatcttacacta       c.*1200

          .         .         .         .         .         .       g.9707
 aaagaatattattgggggaaaaactacaagtgctgtacatatgctgagaaactgcagagc       c.*1260

          .         .         .         .         .         .       g.9767
 ataatactgccacccaaaaatctttttgaaaatcatttccagacaacctcttactttctg       c.*1320

          .         .         .         .         .         .       g.9827
 tgtagtttttaattgttaaaaaaaaaaagttttaaacagaagcacatgacatatgaaagc       c.*1380

          .         .         .         .         .         .       g.9887
 ctgcaggactggtcgtttttttggcaattcttccacgtgggacttgtccacaagaatgaa       c.*1440

          .         .         .         .         .         .       g.9947
 agtagtggtttttaaagagttaagttacatatttattttctcacttaagttatttatgca       c.*1500

          .         .         .         .         .         .       g.10007
 aaagtttttcttgtagagaatgacaatgttaatattgctttatgaattaacagtctgttc       c.*1560

          .         .         .         .         .                 g.10058
 ttccagagtccagagacattgttaataaagacaatgaatcatgaccgaaag                c.*1611

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Sclerostin protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.