SRY (sex determining region Y)-box 2 (SOX2) - coding DNA reference sequence

(used for variant description)

(last modified November 10, 2025)

This file was created to facilitate the description of sequence variants on transcript NM_003106.3 in the SOX2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000003.11, covering SOX2 transcript NM_003106.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5017
                                            ggatggttgtctattaa       c.-421

 .         .         .         .         .         .                g.5077
 cttgttcaaaaaagtatcaggagttgtcaaggcagagaagagagtgtttgcaaaaggggg       c.-361

 .         .         .         .         .         .                g.5137
 aaagtagtttgctgcctctttaagactaggactgagagaaagaagaggagagagaaagaa       c.-301

 .         .         .         .         .         .                g.5197
 agggagagaagtttgagccccaggcttaagcctttccaaaaaataataataacaatcatc       c.-241

 .         .         .         .         .         .                g.5257
 ggcggcggcaggatcggccagaggaggagggaagcgctttttttgatcctgattccagtt       c.-181

 .         .         .         .         .         .                g.5317
 tgcctctctctttttttcccccaaattattcttcgcctgattttcctcgcggagccctgc       c.-121

 .         .         .         .         .         .                g.5377
 gctcccgacacccccgcccgcctcccctcctcctctccccccgcccgcgggccccccaaa       c.-61

 .         .         .         .         .         .                g.5437
 gtcccggccgggccgagggtcggcggccgccggcgggccgggcccgcgcacagcgcccgc       c.-1

          .         .         .         .         .         .       g.5497
 ATGTACAACATGATGGAGACGGAGCTGAAGCCGCCGGGCCCGCAGCAAACTTCGGGGGGC       c.60
 M  Y  N  M  M  E  T  E  L  K  P  P  G  P  Q  Q  T  S  G  G         p.20

          .         .         .         .         .         .       g.5557
 GGCGGCGGCAACTCCACCGCGGCGGCGGCCGGCGGCAACCAGAAAAACAGCCCGGACCGC       c.120
 G  G  G  N  S  T  A  A  A  A  G  G  N  Q  K  N  S  P  D  R         p.40

          .         .         .         .         .         .       g.5617
 GTCAAGCGGCCCATGAATGCCTTCATGGTGTGGTCCCGCGGGCAGCGGCGCAAGATGGCC       c.180
 V  K  R  P  M  N  A  F  M  V  W  S  R  G  Q  R  R  K  M  A         p.60

          .         .         .         .         .         .       g.5677
 CAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAGCGCCTGGGCGCCGAGTGGAAA       c.240
 Q  E  N  P  K  M  H  N  S  E  I  S  K  R  L  G  A  E  W  K         p.80

          .         .         .         .         .         .       g.5737
 CTTTTGTCGGAGACGGAGAAGCGGCCGTTCATCGACGAGGCTAAGCGGCTGCGAGCGCTG       c.300
 L  L  S  E  T  E  K  R  P  F  I  D  E  A  K  R  L  R  A  L         p.100

          .         .         .         .         .         .       g.5797
 CACATGAAGGAGCACCCGGATTATAAATACCGGCCCCGGCGGAAAACCAAGACGCTCATG       c.360
 H  M  K  E  H  P  D  Y  K  Y  R  P  R  R  K  T  K  T  L  M         p.120

          .         .         .         .         .         .       g.5857
 AAGAAGGATAAGTACACGCTGCCCGGCGGGCTGCTGGCCCCCGGCGGCAATAGCATGGCG       c.420
 K  K  D  K  Y  T  L  P  G  G  L  L  A  P  G  G  N  S  M  A         p.140

          .         .         .         .         .         .       g.5917
 AGCGGGGTCGGGGTGGGCGCCGGCCTGGGCGCGGGCGTGAACCAGCGCATGGACAGTTAC       c.480
 S  G  V  G  V  G  A  G  L  G  A  G  V  N  Q  R  M  D  S  Y         p.160

          .         .         .         .         .         .       g.5977
 GCGCACATGAACGGCTGGAGCAACGGCAGCTACAGCATGATGCAGGACCAGCTGGGCTAC       c.540
 A  H  M  N  G  W  S  N  G  S  Y  S  M  M  Q  D  Q  L  G  Y         p.180

          .         .         .         .         .         .       g.6037
 CCGCAGCACCCGGGCCTCAATGCGCACGGCGCAGCGCAGATGCAGCCCATGCACCGCTAC       c.600
 P  Q  H  P  G  L  N  A  H  G  A  A  Q  M  Q  P  M  H  R  Y         p.200

          .         .         .         .         .         .       g.6097
 GACGTGAGCGCCCTGCAGTACAACTCCATGACCAGCTCGCAGACCTACATGAACGGCTCG       c.660
 D  V  S  A  L  Q  Y  N  S  M  T  S  S  Q  T  Y  M  N  G  S         p.220

          .         .         .         .         .         .       g.6157
 CCCACCTACAGCATGTCCTACTCGCAGCAGGGCACCCCTGGCATGGCTCTTGGCTCCATG       c.720
 P  T  Y  S  M  S  Y  S  Q  Q  G  T  P  G  M  A  L  G  S  M         p.240

          .         .         .         .         .         .       g.6217
 GGTTCGGTGGTCAAGTCCGAGGCCAGCTCCAGCCCCCCTGTGGTTACCTCTTCCTCCCAC       c.780
 G  S  V  V  K  S  E  A  S  S  S  P  P  V  V  T  S  S  S  H         p.260

          .         .         .         .         .         .       g.6277
 TCCAGGGCGCCCTGCCAGGCCGGGGACCTCCGGGACATGATCAGCATGTATCTCCCCGGC       c.840
 S  R  A  P  C  Q  A  G  D  L  R  D  M  I  S  M  Y  L  P  G         p.280

          .         .         .         .         .         .       g.6337
 GCCGAGGTGCCGGAACCCGCCGCCCCCAGCAGACTTCACATGTCCCAGCACTACCAGAGC       c.900
 A  E  V  P  E  P  A  A  P  S  R  L  H  M  S  Q  H  Y  Q  S         p.300

          .         .         .         .         .                 g.6391
 GGCCCGGTGCCCGGCACGGCCATTAACGGCACACTGCCCCTCTCACACATGTGA             c.954
 G  P  V  P  G  T  A  I  N  G  T  L  P  L  S  H  M  X               p.317

          .         .         .         .         .         .       g.6451
 gggccggacagcgaactggaggggggagaaattttcaaagaaaaacgagggaaatgggag       c.*60

          .         .         .         .         .         .       g.6511
 gggtgcaaaagaggagagtaagaaacagcatggagaaaacccggtacgctcaaaaagaaa       c.*120

          .         .         .         .         .         .       g.6571
 aaggaaaaaaaaaaatcccatcacccacagcaaatgacagctgcaaaagagaacaccaat       c.*180

          .         .         .         .         .         .       g.6631
 cccatccacactcacgcaaaaaccgcgatgccgacaagaaaacttttatgagagagatcc       c.*240

          .         .         .         .         .         .       g.6691
 tggacttctttttgggggactatttttgtacagagaaaacctggggagggtggggagggc       c.*300

          .         .         .         .         .         .       g.6751
 gggggaatggaccttgtatagatctggaggaaagaaagctacgaaaaactttttaaaagt       c.*360

          .         .         .         .         .         .       g.6811
 tctagtggtacggtaggagctttgcaggaagtttgcaaaagtctttaccaataatattta       c.*420

          .         .         .         .         .         .       g.6871
 gagctagtctccaagcgacgaaaaaaatgttttaatatttgcaagcaacttttgtacagt       c.*480

          .         .         .         .         .         .       g.6931
 atttatcgagataaacatggcaatcaaaatgtccattgtttataagctgagaatttgcca       c.*540

          .         .         .         .         .         .       g.6991
 atatttttcaaggagaggcttcttgctgaattttgattctgcagctgaaatttaggacag       c.*600

          .         .         .         .         .         .       g.7051
 ttgcaaacgtgaaaagaagaaaattattcaaatttggacattttaattgtttaaaaattg       c.*660

          .         .         .         .         .         .       g.7111
 tacaaaaggaaaaaattagaataagtactggcgaaccatctctgtggtcttgtttaaaaa       c.*720

          .         .         .         .         .         .       g.7171
 gggcaaaagttttagactgtactaaattttataacttactgttaaaagcaaaaatggcca       c.*780

          .         .         .         .         .         .       g.7231
 tgcaggttgacaccgttggtaatttataatagcttttgttcgatcccaactttccatttt       c.*840

          .         .         .         .         .         .       g.7291
 gttcagataaaaaaaaccatgaaattactgtgtttgaaatattttcttatggtttgtaat       c.*900

          .         .         .         .         .         .       g.7351
 atttctgtaaatttattgtgatattttaaggttttcccccctttattttccgtagttgta       c.*960

          .         .         .         .         .         .       g.7411
 ttttaaaagattcggctctgtattatttgaatcagtctgccgagaatccatgtatatatt       c.*1020

          .         .         .         .         .         .       g.7471
 tgaactaatatcatccttataacaggtacattttcaacttaagtttttactccattatgc       c.*1080

          .         .         .         .                           g.7513
 acagtttgagataaataaatttttgaaatatggacactgaaa                         c.*1122

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The SRY (sex determining region Y)-box 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.