serine peptidase inhibitor, Kazal type 1 (SPINK1) - coding DNA reference sequence

(used for variant description)

(last modified June 9, 2020)

This file was created to facilitate the description of sequence variants on transcript NM_003122.3 in the SPINK1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_008356.2, covering SPINK1 transcript NM_003122.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
 .         .         .         .         .         .                g.5060
 agcccagtaggtggggccttgctgccatctgccatatgacccttccagtcccaggcttct       c.-61

 .         .         .         .         .         .                g.5120
 gaagagacgtggtaagtgcggtgcagttttcaactgacctctggacgcagaacttcagcc       c.-1

          .         .         .         .         .      | 02  .    g.7072
 ATGAAGGTAACAGGCATCTTTCTTCTCAGTGCCTTGGCCCTGTTGAGTCTATCTG | GTAAC    c.60
 M  K  V  T  G  I  F  L  L  S  A  L  A  L  L  S  L  S  G |   N      p.20

          .         .        | 03.         .         .         .    g.8602
 ACTGGAGCTGACTCCCTGGGAAGAGAG | GCCAAATGTTACAATGAACTTAATGGATGCACC    c.120
 T  G  A  D  S  L  G  R  E   | A  K  C  Y  N  E  L  N  G  C  T      p.40

          .         .         .         .         .         .       g.8662
 AAGATATATGACCCTGTCTGTGGGACTGATGGAAATACTTATCCCAATGAATGCGTGTTA       c.180
 K  I  Y  D  P  V  C  G  T  D  G  N  T  Y  P  N  E  C  V  L         p.60

          .     | 04   .         .         .         .         .    g.12037
 TGTTTTGAAAATCG | GAAACGCCAGACTTCTATCCTCATTCAAAAATCTGGGCCTTGCTGA    c.240
 C  F  E  N  R  |  K  R  Q  T  S  I  L  I  Q  K  S  G  P  C  X      p.79

          .         .         .         .         .         .       g.12097
 gaaccaaggttttgaaatcccatcaggtcaccgcgaggcctgactggccttattgttgaa       c.*60

          .         .                                               g.12118
 taaatgtatctgaatatcccc                                              c.*81

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Serine peptidase inhibitor, Kazal type 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.