sprouty homolog 1, antagonist of FGF signaling (Drosophila) (SPRY1) - coding DNA reference sequence

(used for variant description)

(last modified February 22, 2017)

This file was created to facilitate the description of sequence variants on transcript NM_001258038.1 in the SPRY1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000004.11, covering SPRY1 transcript NM_001258038.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5019
                                          gtagccggagtgagaccgc       c.-421

 .         .         .         .         .         .                g.5079
 tctgcaaaccactgcgtgctttgcagagtgattatcagcacagttccctgccctggataa       c.-361

 .         .         .         .         .         .         | 02    g.5817
 ggaacagctacagtcgctgttaaatgtgcctgaaaagcaatttgcaatctttgcattag | g    c.-301

 .         .         .         .         .         .                g.5877
 catttcggccgtggaaccccaggctcggaggactgggtgtgagcgctgcccgggagaggc       c.-241

 .         .         .         .         .         .                g.5937
 tgacctgccgggaccggagtgcccggggacgctgtgcccccacttgcccaacgtgcggaa       c.-181

 .         .         .         .         .         .                g.5997
 tcggctaagcgcgtcggcctgcgcggggcacaagggacgacgcccgcctttctctctccg       c.-121

 .         .         .         .         .         .                g.6057
 agaaggatccccaaacctcactctcttcactcctccccgctaaaaaaaaaaaaaaaaaga       c.-61

 .     | 03   .         .         .         .         .             g.9797
 aaagg | gatttcagatgcatgccaggtttccactgattgccagaactcgagatcactacac    c.-1

          .         .         .         .         .         .       g.9857
 ATGGATCCCCAAAATCAACATGGCAGTGGCAGTTCGTTAGTTGTGATCCAGCAGCCTTCT       c.60
 M  D  P  Q  N  Q  H  G  S  G  S  S  L  V  V  I  Q  Q  P  S         p.20

          .         .         .         .         .         .       g.9917
 TTGGATAGCCGTCAGAGATTAGACTATGAGAGAGAGATTCAGCCTACTGCTATTTTGTCC       c.120
 L  D  S  R  Q  R  L  D  Y  E  R  E  I  Q  P  T  A  I  L  S         p.40

          .         .         .         .         .         .       g.9977
 TTAGACCAGATCAAGGCCATAAGAGGCAGCAATGAATACACAGAAGGGCCTTCGGTGGTG       c.180
 L  D  Q  I  K  A  I  R  G  S  N  E  Y  T  E  G  P  S  V  V         p.60

          .         .         .         .         .         .       g.10037
 AAAAGACCTGCTCCTCGGACAGCACCAAGACAAGAAAAGCATGAAAGGACTCATGAAATC       c.240
 K  R  P  A  P  R  T  A  P  R  Q  E  K  H  E  R  T  H  E  I         p.80

          .         .         .         .         .         .       g.10097
 ATACCAATTAATGTGAATAATAACTACGAGCACAGACACACAAGCCACCTGGGACATGCA       c.300
 I  P  I  N  V  N  N  N  Y  E  H  R  H  T  S  H  L  G  H  A         p.100

          .         .         .         .         .         .       g.10157
 GTACTCCCAAGTAATGCCAGGGGCCCCATTTTGAGCAGATCAACCAGCACTGGAAGTGCA       c.360
 V  L  P  S  N  A  R  G  P  I  L  S  R  S  T  S  T  G  S  A         p.120

          .         .         .         .         .         .       g.10217
 GCCAGCTCTGGGAGCAACAGCAGTGCCTCTTCTGAACAGGGACTGTTAGGAAGGTCACCA       c.420
 A  S  S  G  S  N  S  S  A  S  S  E  Q  G  L  L  G  R  S  P         p.140

          .         .         .         .         .         .       g.10277
 CCAACCAGACCAGTCCCTGGTCATAGGTCTGAAAGGGCAATCCGGACCCAGCCCAAGCAA       c.480
 P  T  R  P  V  P  G  H  R  S  E  R  A  I  R  T  Q  P  K  Q         p.160

          .         .         .         .         .         .       g.10337
 CTGATTGTGGATGACTTGAAGGGTTCCTTGAAAGAGGACCTGACACAGCACAAGTTCATT       c.540
 L  I  V  D  D  L  K  G  S  L  K  E  D  L  T  Q  H  K  F  I         p.180

          .         .         .         .         .         .       g.10397
 TGTGAACAGTGTGGGAAGTGCAAGTGTGGAGAATGCACTGCTCCCAGGACCCTACCATCC       c.600
 C  E  Q  C  G  K  C  K  C  G  E  C  T  A  P  R  T  L  P  S         p.200

          .         .         .         .         .         .       g.10457
 TGTTTGGCCTGTAACCGGCAGTGCCTTTGCTCTGCTGAGAGCATGGTGGAATATGGAACC       c.660
 C  L  A  C  N  R  Q  C  L  C  S  A  E  S  M  V  E  Y  G  T         p.220

          .         .         .         .         .         .       g.10517
 TGCATGTGCTTAGTCAAGGGCATCTTCTACCACTGCTCCAATGACGACGAAGGGGATTCC       c.720
 C  M  C  L  V  K  G  I  F  Y  H  C  S  N  D  D  E  G  D  S         p.240

          .         .         .         .         .         .       g.10577
 TATTCAGATAATCCTTGCTCCTGTTCACAATCACACTGCTGCTCTAGATACCTGTGTATG       c.780
 Y  S  D  N  P  C  S  C  S  Q  S  H  C  C  S  R  Y  L  C  M         p.260

          .         .         .         .         .         .       g.10637
 GGAGCCATGTCTTTATTTTTACCTTGCTTACTCTGTTATCCTCCTGCTAAAGGATGCCTG       c.840
 G  A  M  S  L  F  L  P  C  L  L  C  Y  P  P  A  K  G  C  L         p.280

          .         .         .         .         .         .       g.10697
 AAGCTGTGCAGGAGGTGTTATGACTGGATCCATCGCCCAGGGTGCAGATGTAAGAACTCC       c.900
 K  L  C  R  R  C  Y  D  W  I  H  R  P  G  C  R  C  K  N  S         p.300

          .         .         .         .         .         .       g.10757
 AACACTGTCTATTGTAAGCTGGAGAGCTGCCCCTCCCGGGGTCAGGGTAAACCATCATGA       c.960
 N  T  V  Y  C  K  L  E  S  C  P  S  R  G  Q  G  K  P  S  X         p.319

          .         .         .         .         .         .       g.10817
 tttttggaggtgggttgtacctcctgaacttttagctttcaagttgtggctgttttttgt       c.*60

          .         .         .         .         .         .       g.10877
 ttttgtttttgtttttgttttctttagaatttttccctgtttcccaccttctcttcccct       c.*120

          .         .         .         .         .         .       g.10937
 gttgccaaggtctaactcatggatttttctctttcctcatggatgatcttcagcaagagt       c.*180

          .         .         .         .         .         .       g.10997
 ggactgggaagctgcacctggctcccactttcaacaagagcctctgccatccacttgagg       c.*240

          .         .         .         .         .         .       g.11057
 gtattgagagccagtgggcttttgtgtagcctttttgttctgcaagcaactttctaaagt       c.*300

          .         .         .         .         .         .       g.11117
 tgtgtacatgaacatacacccacatccagactacagtgatttagagttgttttgattggg       c.*360

          .         .         .         .         .         .       g.11177
 taccgtgggagcagggaaattggttttttaaaaagcaactgtttaattgcttaaataagc       c.*420

          .         .         .         .         .         .       g.11237
 tatgtattaaatctgtctccagttagggctatcttcctagcataggccccttaagtagca       c.*480

          .         .         .         .         .         .       g.11297
 tgggggatatattttttgctataacgtaaaaattttcctttaaccactgccctctccttc       c.*540

          .         .         .         .         .         .       g.11357
 tttctccttcaaggttctttccccctcagttttgttgttgtcttactctggagatgccaa       c.*600

          .         .         .         .         .         .       g.11417
 gtgtattttttctttctatgtaattttagattcgccttacaatgtaaatcttcacattgg       c.*660

          .         .         .         .         .         .       g.11477
 agataatattggttggaccttgcccatcttcactctagccttcgtatttgtgaaggactc       c.*720

          .         .         .         .         .         .       g.11537
 agccaccttccttcttcaccccatgcttctcaccaaatttttgttgtcattgagggcact       c.*780

          .         .         .         .         .         .       g.11597
 tggataactcaagttgatatttatagctgatcaatctatatgtgtcacagaactatgctg       c.*840

          .         .         .         .         .         .       g.11657
 cctaaagtgatcttggctccttaatggtccttttggccccttggatagttaacagctgag       c.*900

          .         .         .         .         .         .       g.11717
 taattctaatctcttctgtgttttccttgccttaaccacaaattgtggtgctttttgtat       c.*960

          .         .         .         .         .         .       g.11777
 attttatgtataaatcacaaagttgaattctgactatttttaagacaaaagtctgttaaa       c.*1020

          .         .         .         .         .         .       g.11837
 cttttttattgtaaagaatatttattatgcgaatctctattattttatggtatttattgc       c.*1080

          .         .         .         .         .         .       g.11897
 aaaagactgttgaaatgtactcatgtttgaatataacaaaatatcaatacttaacggaaa       c.*1140

          .         .         .         .         .         .       g.11957
 ataaggtgacacgaagaaagtacatatgttaactataatgcagaaaatatattaattaat       c.*1200

                                                                    g.11966
 gaaactgtc                                                          c.*1209

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Sprouty homolog 1, antagonist of FGF signaling (Drosophila) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.