serine palmitoyltransferase, long chain base subunit 2 (SPTLC2) - coding DNA reference sequence

(used for variant description)

(last modified December 30, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_004863.3 in the SPTLC2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_028282.1, covering SPTLC2 transcript NM_004863.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5008
                                                     ccttggcc       c.-181

 .         .         .         .         .         .                g.5068
 gagaccggtcctctgcggagagggccccgccctctgtgaaggcccgcccgggaattggcg       c.-121

 .         .         .         .         .         .                g.5128
 gcggcgctgcagccatttccggtttcggggaggtgggtggggtgcggagcgggacttgga       c.-61

 .         .         .         .         .         .                g.5188
 gcagccgccgccgctgccaccgcctacagagcctgccttgcgcctggtgctgccaggaag       c.-1

          .         .         .         .         .         .       g.5248
 ATGCGGCCGGAGCCCGGAGGCTGCTGCTGCCGCCGCACGGTGCGGGCGAATGGCTGCGTG       c.60
 M  R  P  E  P  G  G  C  C  C  R  R  T  V  R  A  N  G  C  V         p.20

          .         .         .         .         .         .       g.5308
 GCGAACGGGGAAGTACGGAACGGGTACGTGAGGAGCAGCGCTGCAGCCGCAGCCGCAGCC       c.120
 A  N  G  E  V  R  N  G  Y  V  R  S  S  A  A  A  A  A  A  A         p.40

          .   | 02     .         .         .         .         .    g.24435
 GCCGCCGGCCAG | ATCCATCATGTTACACAAAATGGAGGACTATATAAAAGACCGTTTAAT    c.180
 A  A  G  Q   | I  H  H  V  T  Q  N  G  G  L  Y  K  R  P  F  N      p.60

          .         .         .         .         .         .       g.24495
 GAAGCTTTTGAAGAAACACCAATGCTGGTTGCTGTGCTCACGTATGTGGGGTATGGCGTA       c.240
 E  A  F  E  E  T  P  M  L  V  A  V  L  T  Y  V  G  Y  G  V         p.80

          .         .         .         .         .         .       g.24555
 CTCACCCTCTTTGGATATCTTCGAGATTTCTTGAGGTATTGGAGAATTGAAAAGTGTCAC       c.300
 L  T  L  F  G  Y  L  R  D  F  L  R  Y  W  R  I  E  K  C  H         p.100

          .         .        | 03.         .         .         .    g.42691
 CATGCAACAGAAAGAGAAGAACAAAAG | GACTTTGTGTCATTGTATCAAGATTTTGAAAAC    c.360
 H  A  T  E  R  E  E  Q  K   | D  F  V  S  L  Y  Q  D  F  E  N      p.120

          .         .         .         .         .         .       g.42751
 TTTTATACAAGGAATCTGTACATGAGGATAAGAGACAACTGGAATCGGCCAATCTGTAGT       c.420
 F  Y  T  R  N  L  Y  M  R  I  R  D  N  W  N  R  P  I  C  S         p.140

          .         .         .         .         .         .       g.42811
 GTGCCTGGAGCCAGGGTGGACATCATGGAGAGACAGTCTCATGATTATAACTGGTCCTTC       c.480
 V  P  G  A  R  V  D  I  M  E  R  Q  S  H  D  Y  N  W  S  F         p.160

    | 04     .         .         .         .         .         .    g.44910
 AA | GTATACAGGGAATATAATAAAGGGTGTTATAAACATGGGTTCCTACAACTATCTTGGA    c.540
 K  |  Y  T  G  N  I  I  K  G  V  I  N  M  G  S  Y  N  Y  L  G      p.180

          .         .         .         .         .         .       g.44970
 TTTGCACGGAATACTGGATCATGTCAAGAAGCAGCCGCCAAAGTCCTTGAGGAGTATGGA       c.600
 F  A  R  N  T  G  S  C  Q  E  A  A  A  K  V  L  E  E  Y  G         p.200

          .         .         .  | 05      .         .         .    g.51288
 GCTGGAGTGTGCAGTACTCGGCAGGAAATTG | GAAACCTGGACAAGCATGAAGAACTAGAG    c.660
 A  G  V  C  S  T  R  Q  E  I  G |   N  L  D  K  H  E  E  L  E      p.220

          .         .         .         .         .         .       g.51348
 GAGCTTGTAGCAAGGTTCTTAGGAGTAGAAGCTGCTATGGCGTATGGCATGGGATTTGCA       c.720
 E  L  V  A  R  F  L  G  V  E  A  A  M  A  Y  G  M  G  F  A         p.240

          .         .         .       | 06 .         .         .    g.59302
 ACGAATTCAATGAACATTCCTGCTCTTGTTGGCAAA | GGTTGCCTGATTCTGAGTGATGAA    c.780
 T  N  S  M  N  I  P  A  L  V  G  K   | G  C  L  I  L  S  D  E      p.260

          .         .         .         .         .         .       g.59362
 CTGAATCATGCATCACTGGTTCTGGGAGCCAGACTGTCAGGAGCAACCATTAGAATCTTC       c.840
 L  N  H  A  S  L  V  L  G  A  R  L  S  G  A  T  I  R  I  F         p.280

          . | 07       .         .         .         .         .    g.64671
 AAACACAACA | ATATGCAAAGCCTAGAGAAGCTATTGAAAGATGCCATTGTTTATGGTCAG    c.900
 K  H  N  N |   M  Q  S  L  E  K  L  L  K  D  A  I  V  Y  G  Q      p.300

          .         .         .         .         .       | 08 .    g.66252
 CCTCGGACACGAAGGCCCTGGAAGAAAATTCTCATCCTTGTGGAAGGAATATATAG | CATG    c.960
 P  R  T  R  R  P  W  K  K  I  L  I  L  V  E  G  I  Y  S  |  M      p.320

          .         .         .         .         .         .       g.66312
 GAGGGATCTATTGTTCGTCTTCCTGAAGTGATTGCCCTCAAGAAGAAATACAAGGCATAC       c.1020
 E  G  S  I  V  R  L  P  E  V  I  A  L  K  K  K  Y  K  A  Y         p.340

          .         .         .         .         .         .       g.66372
 TTGTATCTGGATGAGGCTCACAGCATTGGCGCCCTGGGCCCCACAGGCCGGGGTGTGGTG       c.1080
 L  Y  L  D  E  A  H  S  I  G  A  L  G  P  T  G  R  G  V  V         p.360

          .         .         .         .         .         .       g.66432
 GAGTACTTTGGCCTGGATCCCGAGGATGTGGATGTTATGATGGGAACGTTCACAAAGAGT       c.1140
 E  Y  F  G  L  D  P  E  D  V  D  V  M  M  G  T  F  T  K  S         p.380

          .         .         .       | 09 .         .         .    g.69569
 TTTGGTGCTTCTGGAGGATATATTGGAGGCAAGAAG | GAGCTGATAGACTACCTGCGAACA    c.1200
 F  G  A  S  G  G  Y  I  G  G  K  K   | E  L  I  D  Y  L  R  T      p.400

          .         .         .         .         .         .       g.69629
 CATTCTCATAGTGCAGTGTATGCCACGTCATTGTCACCTCCTGTAGTGGAGCAGATCATC       c.1260
 H  S  H  S  A  V  Y  A  T  S  L  S  P  P  V  V  E  Q  I  I         p.420

          .         .         .         .    | 10    .         .    g.100203
 ACCTCCATGAAGTGCATCATGGGGCAGGATGGCACCAGCCTTG | GTAAAGAGTGTGTACAA    c.1320
 T  S  M  K  C  I  M  G  Q  D  G  T  S  L  G |   K  E  C  V  Q      p.440

          .         .         .         .         .         .       g.100263
 CAGTTAGCTGAAAACACCAGGTATTTCAGGAGACGCCTGAAAGAGATGGGCTTCATCATC       c.1380
 Q  L  A  E  N  T  R  Y  F  R  R  R  L  K  E  M  G  F  I  I         p.460

          .         .         .         .         .          | 11    g.103601
 TATGGAAATGAAGACTCTCCAGTAGTGCCTTTGATGCTCTACATGCCTGCCAAAATTGG | C    c.1440
 Y  G  N  E  D  S  P  V  V  P  L  M  L  Y  M  P  A  K  I  G  |      p.480

          .         .         .         .         .         .       g.103661
 GCCTTTGGACGGGAGATGCTGAAGCGGAACATCGGTGTCGTTGTGGTTGGATTTCCTGCC       c.1500
 A  F  G  R  E  M  L  K  R  N  I  G  V  V  V  V  G  F  P  A         p.500

          .         .         .         .         .         .       g.103721
 ACCCCAATTATTGAGTCCAGAGCCAGGTTTTGCCTGTCAGCAGCTCATACCAAAGAAATA       c.1560
 T  P  I  I  E  S  R  A  R  F  C  L  S  A  A  H  T  K  E  I         p.520

           | 12        .         .         .         .         .    g.109415
 CTTGATACT | GCTTTAAAGGAGATAGATGAAGTTGGGGACCTATTGCAGCTGAAGTATTCC    c.1620
 L  D  T   | A  L  K  E  I  D  E  V  G  D  L  L  Q  L  K  Y  S      p.540

          .         .         .         .         .         .       g.109475
 CGTCATCGGTTGGTACCTCTACTGGACAGGCCCTTTGACGAGACGACGTATGAAGAAACA       c.1680
 R  H  R  L  V  P  L  L  D  R  P  F  D  E  T  T  Y  E  E  T         p.560

                                                                    g.109484
 GAAGACTGA                                                          c.1689
 E  D  X                                                            p.562

          .         .         .         .         .         .       g.109544
 gcctttttggtgctccctcagaggaactctccctcacccaggacagcctgtggcctttgt       c.*60

          .         .         .         .         .         .       g.109604
 gagccagttccaggaaccacacttctgtggccatctcacgtgaaagacattgcctcagct       c.*120

          .         .         .         .         .         .       g.109664
 actgaaggtggccacctccactctaaatgacattttgtaaatagtaaaaaactgcttcta       c.*180

          .         .         .         .         .         .       g.109724
 atccttcctttgctaaatctcacctttaaaaacgaaggtgactcactttgctttttcagt       c.*240

          .         .         .         .         .         .       g.109784
 ccattaaaaaaacattttattttgcaaccattctacttgtgaaatcacgctgaccctagc       c.*300

          .         .         .         .         .         .       g.109844
 ctgtctctggctaaccacacaggccattcccctctcccagcaccttgcagacttgggccc       c.*360

          .         .         .         .         .         .       g.109904
 atcaagagctactgctggccctggctccgcagcctggatacttacctggccctcctccct       c.*420

          .         .         .         .         .         .       g.109964
 agggagcaagtgccttccacttacttcccatccaggtctcagaggtctcaaggccaacct       c.*480

          .         .         .         .         .         .       g.110024
 tggaatccttatttaaccattcaagtaatcaacggaagttttcaccctttaatcttaagt       c.*540

          .         .         .         .         .         .       g.110084
 ttagccttttaagaaaaacagtaagcgatgactgctgaaaggctcattgtgtaatctccc       c.*600

          .         .         .         .         .         .       g.110144
 aagggtttggtcttattccattttcttctggtcaccagatgatttcttcctttaccatca       c.*660

          .         .         .         .         .         .       g.110204
 aatacttcttcataatggtcacagtctgaggatgtgcgcaaattctggttcttcccaagc       c.*720

          .         .         .         .         .         .       g.110264
 tctaaccgtaacacgtcccaccccctttttaaagcacttactgttttcagagcacccata       c.*780

          .         .         .         .         .         .       g.110324
 tcccaccctggtgagaaggccactctcacatctgagtgttgggtacaaagctgctccgta       c.*840

          .         .         .         .         .         .       g.110384
 gagtgatgtgcactcctggtgggtgaggggcaggggcagtggcagtgtgcaaagaattga       c.*900

          .         .         .         .         .         .       g.110444
 ttactccttgcagagcctgtggcttgcatttcctactgctttctacgtttgaaaattatg       c.*960

          .         .         .         .         .         .       g.110504
 acagtctctggctaggtctgggtccagattaggatttaaactgataaaggaaactgttgg       c.*1020

          .         .         .         .         .         .       g.110564
 taaatcctctgctcagaaagcatttatcatgttcctatttaaggattaggtttattaatt       c.*1080

          .         .         .         .         .         .       g.110624
 taggcctcttagaagctaacccacttaaatattactcttctgaatgctagttctctttta       c.*1140

          .         .         .         .         .         .       g.110684
 ttcttgatgtcctaagtcaattgaatctggcatctggggctagggtctgcctgtctacat       c.*1200

          .         .         .         .         .         .       g.110744
 attttttatttttttctgagaaattctgaacacatagatctctttcctaaactgacattt       c.*1260

          .         .         .         .         .         .       g.110804
 tctattttgactgttttcatactataaccaggtaaagggacttctttcagagagctttat       c.*1320

          .         .         .         .         .         .       g.110864
 actgcctgaccaaagaacaaatctgaaaatcaccattttaaagttattttttcagttgaa       c.*1380

          .         .         .         .         .         .       g.110924
 ccaaagtttaagtgaagaggacttttggcatattatacccaggatcagtttgtctttttg       c.*1440

          .         .         .         .         .         .       g.110984
 tatccatcaagtattacaggagaaggattgggaacagaatggaaaaacagtgtatgaaag       c.*1500

          .         .         .         .         .         .       g.111044
 tcatgttacaggccgagtgcggtggctcacacctgtaatcctagcactttgggaggctga       c.*1560

          .         .         .         .         .         .       g.111104
 ggcaggtggctcacttgaggtcaggaattcaagaccagcctggccaacatggtgaaaccc       c.*1620

          .         .         .         .         .         .       g.111164
 cgtctctactaaaaagacaaaaaattagctgggcgtggtggcgggcacctataatcccac       c.*1680

          .         .         .         .         .         .       g.111224
 ctacttggtaggctgaggcaggagaatcgcttgaacccaggaggcggaggttgcagtgag       c.*1740

          .         .         .         .         .         .       g.111284
 acgagattgtgccactgcactctagcctgggtgacagagcaaaactgtgtctcaaaaaaa       c.*1800

          .         .         .         .         .         .       g.111344
 aaagtcatgttacacatttaagtttttgaaattgctccttttatcggtaaagattctcaa       c.*1860

          .         .         .         .         .         .       g.111404
 tccaaattctcctgggtgtgttgtcatcagctgtgatatgtttgtgcacattacgtatag       c.*1920

          .         .         .         .         .         .       g.111464
 cagaggatgtaagcaatattattgtttgtgaagttttgtttttaatgtcttgagtatgag       c.*1980

          .         .         .         .         .         .       g.111524
 ttatgtttagtcactgtcagcatctgagaactttaataagcccttgagatattccaaagt       c.*2040

          .         .         .         .         .         .       g.111584
 tttattttacttttttaaagaacagaaaaagatgaatgaaagaaccaaggagagatgcag       c.*2100

          .         .         .         .         .         .       g.111644
 agactatatttagcatgtataggttaaagtaagaaggaggttgtggtaactaaataggag       c.*2160

          .         .         .         .         .         .       g.111704
 tcctataaaatcaaatacattgtcaaccttttctgcacatctagtttcctaccatagaat       c.*2220

          .         .         .         .         .         .       g.111764
 cccactggaataccacatagcttttgcactgcagttactatttactaatgtaaacgtagg       c.*2280

          .         .         .         .         .         .       g.111824
 gtttgtaaaagtcacaaacttataagcaatgaacttacctgctagtctttttattttggc       c.*2340

          .         .         .         .         .         .       g.111884
 ttgcatgaagtcactgcaaattcaaatgtcagtaccggcatttaaaatatatctatatca       c.*2400

          .         .         .         .         .         .       g.111944
 ctttgttggtacaaagttatttcaagataagtgtaattttgttacaagtttattttgaag       c.*2460

          .         .         .         .         .         .       g.112004
 agacaaatctcctgtgatctatgcaggacctctgtactttctaaagaacaaaatgttatg       c.*2520

          .         .         .         .         .         .       g.112064
 tagacattatacatggttggttgtctcttcttgaaactgtaatgtaaatctagggtccag       c.*2580

          .         .         .         .         .         .       g.112124
 tcatatcctaggtatcatcatttatccaagtacttggaggaatacaagtatatataaata       c.*2640

          .         .         .         .         .         .       g.112184
 cagtcattgagaataagtcgatttgaggcatacaagagtagtttcttacacagtttaaca       c.*2700

          .         .         .         .         .         .       g.112244
 cggcctgattcaagactctgataggattcaaacagataccggttaaccatgactaccaaa       c.*2760

          .         .         .         .         .         .       g.112304
 actgatcatctgagtcgattgatagaggtgtgactagtccttagcactttttctcattcc       c.*2820

          .         .         .         .         .         .       g.112364
 tctttttattcagcattgctgttacctatttcaggtttataagacctctttcagcagatc       c.*2880

          .         .         .         .         .         .       g.112424
 acatcagaagccaggaaatgcatagctaggagatgtcaaaagcccatatgaggagtggac       c.*2940

          .         .         .         .         .         .       g.112484
 caagcagcagtggcggtttctcctcgcatctttttttttttaagctttaacttagcaggg       c.*3000

          .         .         .         .         .         .       g.112544
 gcatggactttatagcactttttcaactttttgctttgctttggataagaaatccttacc       c.*3060

          .         .         .         .         .         .       g.112604
 tttaaaaaaagcttctagtctccataacccccaaagtactgcttatttgtttgaagaatc       c.*3120

          .         .         .         .         .         .       g.112664
 cagccatcgtagtgctttagtcactatcgtaaacattcatgatagggcaaggattttaaa       c.*3180

          .         .         .         .         .         .       g.112724
 acaggattcttgcttctgtagtcatcaaggtgaacagaagcatcctacacaaccactaag       c.*3240

          .         .         .         .         .         .       g.112784
 ggctctatgtttgtgtcatgcctcttcaaacaccaaggagttgaacatgcttccagtgat       c.*3300

          .         .         .         .         .         .       g.112844
 ttgtctccgtaatgccttcttcctttatttggcctttctttctttctgtaccttcaagtt       c.*3360

          .         .         .         .         .         .       g.112904
 cttgatttttaaaattccaactctagagaaaaccaatatatggtggtgctgggctttgaa       c.*3420

          .         .         .         .         .         .       g.112964
 gatagcatatcagacgccttggttctgtttgtacacttagccttacatttcaggaggagg       c.*3480

          .         .         .         .         .         .       g.113024
 cttttcattaggggcttaagctagctcctttggcttttaaaaaaaattttttttcaaatt       c.*3540

          .         .         .         .         .         .       g.113084
 tcttcattacctaagggagcctgcatctaaatttctcaactagttcagcctagctgaatt       c.*3600

          .         .         .         .         .         .       g.113144
 ttctagtgtgttatacactttgcttccttcttattggtgaaaaccagggggatgagtggc       c.*3660

          .         .         .         .         .         .       g.113204
 ttccatggagagatttcctgatttctcagggaggaaaaaagtgatgacatttaccactac       c.*3720

          .         .         .         .         .         .       g.113264
 ttttatgtttttcccctttttccaaattgataaggatttctggttcctagtgatccggga       c.*3780

          .         .         .         .         .         .       g.113324
 ttgggcaacagtgcagaactgccagtcatgccgtaggccgtgaagaaagaatgtgagtaa       c.*3840

          .         .         .         .         .         .       g.113384
 ctgttgttttgcaaggatttgtagggttatgggcagttgttgtttgaagcattgctatga       c.*3900

          .         .         .         .         .         .       g.113444
 cctaattcccaaggtatctttcctctcttggtgttctaggtaagccaatgagctttaatc       c.*3960

          .         .         .         .         .         .       g.113504
 tctacttgctataaccgtgtgcttagaaaaagaggtgagagtagtggttttccttcaaac       c.*4020

          .         .         .         .         .         .       g.113564
 tgtccacattcatgaagattatgaattgttaggacagccagggcaagatagaccctgtct       c.*4080

          .         .         .         .         .         .       g.113624
 ctacaaaaatttttttctaaattaaccgggcatggtggtgcctgcctgtagtcccacctg       c.*4140

          .         .         .         .         .         .       g.113684
 tgtgggagaatcacttgagcctgggaggtcaaggctgcagtgagccatgattgcacccct       c.*4200

          .         .         .         .         .         .       g.113744
 gcactccagcctgggtgacagagtgagaccctggctcaataagagggggaaaaaaaattg       c.*4260

          .         .         .         .         .         .       g.113804
 ttaggagctgggtgcggatgcagcctgcaatcccagctacttgagaggctgaggccggag       c.*4320

          .         .         .         .         .         .       g.113864
 gattgcttaaacccaagaatttgagcgtagcctgggcaacacagcaagaccccatctaag       c.*4380

          .         .         .         .         .         .       g.113924
 aaaaaaatgttttttaaatcagcttagcccaaaggggttgtgaatggggaggtataaaaa       c.*4440

          .         .         .         .         .         .       g.113984
 gcaaagattattttttggctactaagccaagaacttacagggattttttttttcagtccc       c.*4500

          .         .         .         .         .         .       g.114044
 agaacctacagataccctgctacttgcttcacgtggatgctcagtgcccagcagccatct       c.*4560

          .         .         .         .         .         .       g.114104
 taatacattaaaccagtttaaaaaataccttccatgtggagaaaaacatgtctttttctc       c.*4620

          .         .         .         .         .         .       g.114164
 gcctcaactttatccacatgaaatatgtgcccatggctgggcgcagtggctcacctgtaa       c.*4680

          .         .         .         .         .         .       g.114224
 tcccaacactttgggaggctgaagcaggcagattgcttgaggccaggagttcgagaacag       c.*4740

          .         .         .         .         .         .       g.114284
 tctggccaacatggcgaaacctcatctctactaaaattacaaaaattagccgggcatggt       c.*4800

          .         .         .         .         .         .       g.114344
 ggcacatgcctgtaatcccagctacgtcaggaggctgaggcacaggaattgcttgaaccc       c.*4860

          .         .         .         .         .         .       g.114404
 aagaggcagaggatgcaatgagccaagatcacaccactgcactccagccttggcgacaga       c.*4920

          .         .         .         .         .         .       g.114464
 gggagactctgtctcaaaaaaaaaaaaaaaaggtgtgcccaggcccctagccattgccat       c.*4980

          .         .         .         .         .         .       g.114524
 gtgcccagccagagagccaaattagagggctggcttccctatcacacagaataaatgcta       c.*5040

          .         .         .         .         .         .       g.114584
 gtgctagccaatgatccctttgcttttaatgtatagaaaatactgttgttccttttgtca       c.*5100

          .         .         .         .         .         .       g.114644
 tttccagtgacatctgttttctaagcagctcttttctagggaggaaaccaaaggggctag       c.*5160

          .         .         .         .         .         .       g.114704
 gttaagaccctaatagaaatgttttttctaatctctggtgagtctggaagtgtcacattc       c.*5220

          .         .         .         .         .         .       g.114764
 acagtccacccttgggagtggcttggtggagctggggacaaggttttgtttactacatag       c.*5280

          .         .         .         .         .         .       g.114824
 tgcacatgataaatggccttaaactgtgattctttctggtaggataagttataataaact       c.*5340

          .         .         .         .         .         .       g.114884
 gaccctaaagaatgcaatggcttttaaactgcagttactgtgttcttaatgaagcaatac       c.*5400

          .         .         .         .         .         .       g.114944
 ccaaagctctgttcttttggagcacttgaggggagcttgaatgaaaggtgcagataagag       c.*5460

          .         .         .         .         .         .       g.115004
 cagtaccttgatcttatgctttctgagtgtcctgccttgttgccatctgcatggatgagt       c.*5520

          .         .         .         .         .         .       g.115064
 gaatgcttctatgcacgaggagactcaagccaactcagagtctgctttttccaacgctct       c.*5580

          .         .         .         .         .         .       g.115124
 tcccaggtttcttttgcaaagcttggtcatttggcccaggtcttcctggaaagtggagta       c.*5640

          .         .         .         .         .         .       g.115184
 catgtcactgactagggtggcgtggtgtctttacccttaacattaagtcttgttacctca       c.*5700

          .         .         .         .         .         .       g.115244
 gtgatgtgaagccaatggttggaattataaaaagcatccttgctggttcttcacaggaca       c.*5760

          .         .         .         .         .         .       g.115304
 ctggaacccaccctgtcaattcagctagcatgtccacacagtcttgatgatccctctctg       c.*5820

          .         .         .         .         .         .       g.115364
 taacaggcagctaacattaagagaagggggaaagagaagaagagagcaatagcttatggg       c.*5880

          .         .         .         .         .         .       g.115424
 agagctgagatcttacttcgttgacccatatttttcccctgaccaagttacctgtaaact       c.*5940

          .         .         .         .         .         .       g.115484
 ggaatttgcaaggggatgctgtgatgataacccctttctattgctgtaatgttcatataa       c.*6000

          .         .         .         .         .         .       g.115544
 cctgggaaactgagagaaggggatgtgtaaataaaagcttaaacattttagtaatgtgtt       c.*6060

          .         .         .         .         .         .       g.115604
 aaaatgtcactctctcttaccctgtttcccttttttgccagatgatgatttttttatttt       c.*6120

          .         .         .         .         .         .       g.115664
 tattttgtactttactggatgactgtgaagcgatgagtattgggttggggtaggtgtgtt       c.*6180

          .         .         .         .         .         .       g.115724
 gattttgagagtgcatgttaagaactgaaggggaactacttgagatgacttaagaagcat       c.*6240

          .         .         .         .                           g.115771
 cccatgcaaatatcttgttttgccctaataaaatattcagaaagata                    c.*6287

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Serine palmitoyltransferase, long chain base subunit 2 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 22
©2004-2019 Leiden University Medical Center