serine/arginine-rich splicing factor 3 (SRSF3) - coding DNA reference sequence

(used for variant description)

(last modified September 4, 2026)


This file was created to facilitate the description of sequence variants on transcript NM_003017.4 in the SRSF3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering SRSF3 transcript NM_003017.4.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5051
          atgtgattccagtatggcgtataaataaaggcgaggagaaggcggtggtcc       c.-121

 .         .         .         .         .         .                g.5111
 gccatttcgtggacgccgggtgagtgagagagttggttggtgttgggccggaggaaagcg       c.-61

 .         .         .         .         .         .        | 02    g.7450
 ggaagactcatcggagcgtgtggatttgagccgccgcattttttaaccctagatctcg | aa    c.-1

          .         .         .         .         .         .       g.7510
 ATGCATCGTGATTCCTGTCCATTGGACTGTAAGGTTTATGTAGGCAATCTTGGAAACAAT       c.60
 M  H  R  D  S  C  P  L  D  C  K  V  Y  V  G  N  L  G  N  N         p.20

          .         .         .         .         .         .       g.7570
 GGCAACAAGACGGAATTGGAACGGGCTTTTGGCTACTATGGACCACTCCGAAGTGTGTGG       c.120
 G  N  K  T  E  L  E  R  A  F  G  Y  Y  G  P  L  R  S  V  W         p.40

          .         .         .         .         .         .       g.7630
 GTTGCTAGAAACCCACCCGGCTTTGCTTTTGTTGAATTTGAAGATCCCCGAGATGCAGCT       c.180
 V  A  R  N  P  P  G  F  A  F  V  E  F  E  D  P  R  D  A  A         p.60

          .         .       | 03 .         .         .         .    g.9570
 GATGCAGTCCGAGAGCTAGATGGAAG | AACACTATGTGGCTGCCGTGTAAGAGTGGAACTG    c.240
 D  A  V  R  E  L  D  G  R  |  T  L  C  G  C  R  V  R  V  E  L      p.80

          .         .         .         .         .         .       g.9630
 TCGAATGGTGAAAAAAGAAGTAGAAATCGTGGCCCACCTCCCTCTTGGGGTCGTCGCCCT       c.300
 S  N  G  E  K  R  S  R  N  R  G  P  P  P  S  W  G  R  R  P         p.100

          .         .         .         .  | 04      .         .    g.11858
 CGAGATGATTATCGTAGGAGGAGTCCTCCACCTCGTCGCAG | ATCTCCAAGAAGGAGAAGC    c.360
 R  D  D  Y  R  R  R  S  P  P  P  R  R  R  |  S  P  R  R  R  S      p.120

          .         . | 05       .         .         .         .    g.12435
 TTCTCTCGCAGCCGGAGCAG | GTCCCTTTCTAGAGATAGGAGAAGAGAGAGATCGCTGTCT    c.420
 F  S  R  S  R  S  R  |  S  L  S  R  D  R  R  R  E  R  S  L  S      p.140

          .         .         .         .        | 06.         .    g.12662
 CGGGAGAGAAATCACAAGCCGTCCCGATCCTTCTCTAGGTCTCGTAG | TCGATCTAGGTCA    c.480
 R  E  R  N  H  K  P  S  R  S  F  S  R  S  R  S  |  R  S  R  S      p.160

          .                                                         g.12677
 AATGAAAGGAAATAG                                                    c.495
 N  E  R  K  X                                                      p.164

          .         .         .         .         .         .       g.12737
 aagacagtttgcaagagaagtggtgtacaggaaattacttcatttgacaggagtatgtac       c.*60

          .         .         .         .         .         .       g.12797
 agaaaattcaagttttgtttgagacttcataagcttggtgcatttttaagatgttttagc       c.*120

          .         .         .         .         .         .       g.12857
 tgttcaaatctgtttgtctcttgaaacagtgacacaaaggtgtaattctctatggtttga       c.*180

          .         .         .         .         .         .       g.12917
 aatggatcatacgaggcatgtaataccaagaattgttactttacaatgttcccttaagca       c.*240

          .         .         .         .         .         .       g.12977
 aaattgaatttgctttgaacttttagttatgcacagactgataataaacctctaaacctg       c.*300

          .         .         .         .         .         .       g.13037
 cccagcggaagtgtgtttttttttaaatttaaatacagaaacaactggcaaaaattgaac       c.*360

          .         .         .         .         .         .       g.13097
 taagatttacttttttttccatagctgggatataggctgcagctatagttgaacaagcag       c.*420

          .         .         .         .         .         .       g.13157
 tctttaaaaactgctgtgaaacacaggccatcagggaaaacgaaatgctgcactattaaa       c.*480

          .         .         .         .         .         .       g.13217
 ttagaggtttttgaaaaatccaactctcatcctgggcagaggttgcctagttggtataga       c.*540

          .         .         .         .         .         .       g.13277
 atgttaagtttcaagaaagtttacctttgctttaggtcataagttccttatttgattgct       c.*600

          .         .         .         .         .         .       g.13337
 gtatatggatacatggctgttcgtgacattctttatgtgcaaatttgtgatttcaaaaat       c.*660

          .         .         .         .         .         .       g.13397
 gtcctgccagtttaagggtacattgtagagccgaactttgagttactgtgcaagattttt       c.*720

          .         .         .         .         .         .       g.13457
 ttttcatgctgtcatttgtaatatgttttgtgagaatccttgggattaaagttttggtta       c.*780

          .         .         .         .         .         .       g.13517
 caaattgttctttaacttgaaagcctgtttttccttgcaaactcaaatctgtgagcttgg       c.*840

          .         .         .         .         .         .       g.13577
 taccaagtccaggtataacattcctattggaagccatacttatattttcttgtaaagtgc       c.*900

          .         .         .         .         .         .       g.13637
 ttttgaattaataaaatattagcataattgtgtatagtcagttgaacccactgttaccat       c.*960

          .         .         .         .         .         .       g.13697
 tgttcttatcccatgggaagcagttggttacacgattcttattttataagaaacagctga       c.*1020

          .         .         .         .         .         .       g.13757
 gaggcactatggattagtcttctgaagtgaaggaaatatagatgtcacctaagtgatagt       c.*1080

          .         .         .         .         .         .       g.13817
 taacccattttttttttttttaggcatagaagccagttcagggtccataatatttagtga       c.*1140

          .         .         .         .         .         .       g.13877
 ccaacattttaaagtatagcagcaacctggttcttaaacacaaagtaagttgcccattaa       c.*1200

          .         .         .         .         .         .       g.13937
 caaatggcttttatctttagcatgaaaactttccacaggtctaaaaattgcttccatttt       c.*1260

          .         .         .         .         .         .       g.13997
 ataatttgaggtgttgcatgggaattctaagctgatccatcatgatgtaaaagttcacaa       c.*1320

          .         .         .         .         .         .       g.14057
 tatggttcaaatgtaacagtgcagaattgaatatggaggcatgcataaccttcctcttag       c.*1380

          .         .         .         .         .         .       g.14117
 aaaatggcaggtgttgtaatttcaaatttttgtgcaattagattaaatcataatgcaaca       c.*1440

          .         .         .         .         .         .       g.14177
 gtcttgtggcttagtttccttaaatatgctcttaagatagttttggattatgcggtattg       c.*1500

          .         .         .         .         .         .       g.14237
 actgtcttaaatatgaaagataagtcattgcattaagagttcaagctaaatggatacatt       c.*1560

          .         .         .         .         .         .       g.14297
 aagatacagttcctaaacaaattatttatttccaccttttacacaaatcttgggagaatt       c.*1620

          .         .         .         .         .         .       g.14357
 ggtgtcaggaaggttcagccttaaagttaagcatgttcaagaaagacacttttcagacag       c.*1680

          .         .         .         .         .         .       g.14417
 cctgtttatttactgagagctctggcattgggcattttgtctttagtattctcacatagc       c.*1740

          .         .         .         .         .         .       g.14477
 ctacaacctgttcctgttaggaacaagccaagatagctaagaagttacggaagccatgca       c.*1800

          .         .         .         .         .         .       g.14537
 atatgtcaattacattgctttttataaatggacaacttatgtgggcatttttgggcagta       c.*1860

          .         .         .         .         .         .       g.14597
 tatgacttccttgcaggctcttaagttggaagggtttctgtaaaaaggacagttacgggt       c.*1920

          .         .         .         .         .         .       g.14657
 ataatatggctaagagaaataatacagaacctgaaataaaagtaacttcaccagggagtt       c.*1980

          .         .         .         .         .         .       g.14717
 atcctgacttaggtgacatacagtcccagttggcagttactttaaccaggagccctagca       c.*2040

          .         .         .         .         .         .       g.14777
 taacctcaagactcttagaaactttagaacatggaaattgttaaaagctttgaattgcac       c.*2100

          .         .         .         .         .         .       g.14837
 atttagattgtggctattaggaatttttaaagttgtaattcctaaaataacaggtcacac       c.*2160

          .         .         .         .         .         .       g.14897
 taaccggtcttgtccatattcagggttgagtgtaaaaatgaaaggaatcacaaaactgaa       c.*2220

          .         .         .         .         .         .       g.14957
 cttagacctgtggtttaaggatcaaggtgttcactagaagtcactgttactaatacttga       c.*2280

          .         .         .         .         .         .       g.15017
 tgacaatgtaaagaaacattaaggattatatttgattgttttcaaagacactggctggat       c.*2340

          .         .         .         .         .         .       g.15077
 gtggtggctcacacttgtaattcctagcactttgggaggctagggcgggtgggaggatct       c.*2400

          .         .         .         .         .         .       g.15137
 cttgaagccaggagttggagaccagtctgcccaacatggcaagattcacatttctattaa       c.*2460

          .                                                         g.15155
 aaggaatatttagtttga                                                 c.*2478

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Serine/arginine-rich splicing factor 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 30b
©2004-2026 Leiden University Medical Center