single-stranded DNA binding protein 1, mitochondrial (SSBP1) - coding DNA reference sequence

(used for variant description)

(last modified August 13, 2019)

This file was created to facilitate the description of sequence variants on transcript NM_003143.2 in the SSBP1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000007.13, covering SSBP1 transcript NM_003143.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5013
                                                ctgtttccttttt       c.-121

 .         .         .         .         .         .                g.5073
 cctctggcgagctttgcgttccctgtgcgccggaagtgatcccctgcgtggctgggctgc       c.-61

 .         .       | 02 .         .         .         .             g.5846
 tcgggttagatcgtcag | gaaaagcctaaagattagactgtaagaaaagaaaatagaagcc    c.-1

          .         .     | 03   .         .         .         .    g.8884
 ATGTTTCGAAGACCTGTATTACAG | GTACTTCGTCAGTTTGTAAGACATGAGTCCGAAACA    c.60
 M  F  R  R  P  V  L  Q   | V  L  R  Q  F  V  R  H  E  S  E  T      p.20

          .         .      | 04  .         .         .         .    g.10275
 ACTACCAGTTTGGTTCTTGAAAGAT | CCCTGAATCGTGTGCACTTACTTGGGCGAGTGGGT    c.120
 T  T  S  L  V  L  E  R  S |   L  N  R  V  H  L  L  G  R  V  G      p.40

          .         .         .         .         .         .       g.10335
 CAGGACCCTGTCTTGAGACAGGTGGAAGGAAAAAATCCAGTCACAATATTTTCTCTAGCA       c.180
 Q  D  P  V  L  R  Q  V  E  G  K  N  P  V  T  I  F  S  L  A         p.60

          .         .         .         .       | 05 .         .    g.10595
 ACTAATGAGATGTGGCGATCAGGGGATAGTGAAGTTTACCAACTGG | GTGATGTCAGTCAA    c.240
 T  N  E  M  W  R  S  G  D  S  E  V  Y  Q  L  G |   D  V  S  Q      p.80

          .         .         .         .         .         .       g.10655
 AAGACAACATGGCACAGAATATCAGTATTCCGGCCAGGCCTCAGAGACGTGGCATATCAA       c.300
 K  T  T  W  H  R  I  S  V  F  R  P  G  L  R  D  V  A  Y  Q         p.100

          .     | 06   .         .         .         .         .    g.12221
 TATGTGAAAAAGGG | GTCTCGAATTTATTTGGAAGGGAAAATAGACTATGGTGAATACATG    c.360
 Y  V  K  K  G  |  S  R  I  Y  L  E  G  K  I  D  Y  G  E  Y  M      p.120

          .         .         .         .    | 07    .         .    g.17007
 GATAAAAATAATGTGAGGCGACAAGCAACAACAATCATAGCTG | ATAATATTATATTTCTG    c.420
 D  K  N  N  V  R  R  Q  A  T  T  I  I  A  D |   N  I  I  F  L      p.140

          .         .                                               g.17034
 AGTGACCAGACGAAAGAGAAGGAGTAG                                        c.447
 S  D  Q  T  K  E  K  E  X                                          p.148

          .         .         .         .         .         .       g.17094
 aaaggatgattcttctttggccatcatttggtacagtctcatttccaagtcatgtataat       c.*60

          .         .         .         .         .         .       g.17154
 ctttatggcttccaaggacaagaattaaaatactcttttacgtaaaatgagtaataatct       c.*120

          .                                                         g.17168
 tttttctgactgtc                                                     c.*134

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Single-stranded DNA binding protein 1, mitochondrial protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.