signal transducer and activator of transcription 5B (STAT5B) - 248 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.61755
gtgagtggggtcctgggcctctcctgggcgtgggtgccatgaagtcagtctctggggacc  c.681+60

         .         .         .         .         .         .  g.61815
cgagggagggctgggaccagcatgagagcagaacctgggagggcaggaggccttttttcc  c.681+120

      g.61819
tggg  c.681+124

--------------------- middle of intron ---------------------
                                             g.61820          g.61823
                                             c.682-124  ggcc  c.682-121

.         .         .         .         .         .           g.61883
ttgcgaggcagagcagcttggggagagggaacggcctgggccctgccctgccatttccca  c.682-61

.         .         .         .         .         .           g.61943
gcgaggccctgcggtgttctctgggagcccagaaggggctgctctcctcccttccctcag  c.682-1


Powered by LOVD v.3.0 Build 18
©2004-2017 Leiden University Medical Center