signal transducer and activator of transcription 5B (STAT5B) - 475 nt intron 18 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.79127
gtaggtggcattcttgtgggggtccacaggggaggaactgggggcttggccccaggctgg  c.2237+60

         .         .         .         .         .         .  g.79187
acccctggagggctggggtcaaaggaatccagagctcctctaggtctgagaccacacagc  c.2237+120

         .         .         .         .         .         .  g.79247
cctggcccgggctctggcctttgggagggagagatttgaccagaagtgattggtggttta  c.2237+180

         .         .         .         .         .          g.79305
gagtcgggttgggcaaatgtcatctgttcccctctctcaatatggagatttttcttgc  c.2237+238

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.79362
   tctaaggactgagtggagttgtgatgtgtctggacagccggtgtgagaggtaacagg  c.2238-181

.         .         .         .         .         .           g.79422
ggagggtatttcagtctgagttgctgtacagccagctgtttgaatggttgttcttttccc  c.2238-121

.         .         .         .         .         .           g.79482
atgaagccccaggctgagggcataggctggctcagactgctcccctggtggcctgtgggg  c.2238-61

.         .         .         .         .         .           g.79542
cttggggtggtctctggcaggctttccccttcccttcatccctcttctttccctcccaag  c.2238-1


Powered by LOVD v.3.0 Build 18
©2004-2017 Leiden University Medical Center