(intronic numbering for coding DNA Reference Sequence)
. . . . . g.15773
gtgagagggggtgcctggactttagtgggagcagggaggctgggaccctagg c.3681+52
--------------------- middle of intron ---------------------
. . . . . g.15825
tatagaacccagctcctatgttctgctctggcctcacactgcttccctacag c.3682-1
Powered by LOVD v.3.0 Build 14c
©2004-2016 Leiden University Medical Center