STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase (STUB1) - 189 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.6549
gtgggaccctcaccccaggccgccctgtcttgggataattctgaatcaccgactcccgac  c.524+60

         .         .         .       g.6584
acaagcgtttatcgaaggctttactggcaagcagg  c.524+95

--------------------- middle of intron ---------------------
                g.6585        .         .         .           g.6618
                c.525-94  aaatgtggggaagtgtggatgttagctctgagat  c.525-61

.         .         .         .         .         .           g.6678
tggggtgtggtcagacatctggccaggtccatctctgaccggctcctggtcaacccccag  c.525-1


Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center