STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase (STUB1) - 139 nt intron 04 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.6826
gtgagggtgccccccacccacatgtgggtctgtgtgtgtgcacgtggcgtgggagcatcc  c.612+60

         .  g.6836
ccgccttgtg  c.612+70

--------------------- middle of intron ---------------------
                                         g.6837               g.6845
                                         c.613-69  ttgggtctg  c.613-61

.         .         .         .         .         .           g.6905
tgccccatggaggagggaggtggggtgtctcccccaagcacagcactcaactcttcacag  c.613-1


Powered by LOVD v.3.0 Build 21
©2004-2018 Leiden University Medical Center