suppressor of Ty 5 homolog (S. cerevisiae) (SUPT5H) - 302 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.19104
gtatgtgctctgatctcggggcttggaggaggtgggagaatgagggaggctgctttgtgg  c.555+60

         .         .         .         .         .         .  g.19164
gggagaagtgtctgtctgtcccgggtctccgtggcctgccagtcacttggtccttctgtc  c.555+120

         .         .         .   g.19195
tccatccctcactccacgttactgactggct  c.555+151

--------------------- middle of intron ---------------------
                  g.19196     .         .         .           g.19226
                  c.556-151  atctcccacctccatcttcctggctgtccat  c.556-121

.         .         .         .         .         .           g.19286
ccttctttctctctcctctcttggtcctactttatttttcttgctgctgtctccttcccc  c.556-61

.         .         .         .         .         .           g.19346
ctttcctgtgtcctttcctccatcctgtcatctctctcaaatctgcctctcatcttccag  c.556-1


Powered by LOVD v.3.0 Build 24
©2004-2020 Leiden University Medical Center