transcription elongation factor A (SII)-like 1 (TCEAL1) - coding DNA reference sequence

(used for variant description)

(last modified November 16, 2022)

This file was created to facilitate the description of sequence variants on transcript NM_004780.2 in the TCEAL1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000023.10, covering TCEAL1 transcript NM_004780.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5298
       tcttttttttgcctgtccaccatctccctattaccctttggtcgagagggaaag       c.-121

 .        | 02.         .         .         .         .             g.5826
 cagaagaa | gtctgctggtcacagcggggcacctcgaggagaggacgactaggagcacacg    c.-61

 .         .         .        | 03.         .         .             g.6197
 gcccggaaaggtccaggtcagggaaggg | aataactgtgcttgaagaagaaaattcccaac    c.-1

          .         .         .         .         .         .       g.6257
 ATGGACAAACCACGCAAAGAAAATGAAGAAGAGCCGCAGAGCGCGCCCAAGACCGATGAG       c.60
 M  D  K  P  R  K  E  N  E  E  E  P  Q  S  A  P  K  T  D  E         p.20

          .         .         .         .         .         .       g.6317
 GAGAGGCCTCCGGTGGAGCACTCTCCCGAAAAGCAGTCCCCCGAGGAGCAGTCTTCGGAG       c.120
 E  R  P  P  V  E  H  S  P  E  K  Q  S  P  E  E  Q  S  S  E         p.40

          .         .         .         .         .         .       g.6377
 GAGCAGTCCTCGGAGGAGGAGTTCTTTCCTGAGGAGCTCTTGCCTGAGCTCCTGCCTGAG       c.180
 E  Q  S  S  E  E  E  F  F  P  E  E  L  L  P  E  L  L  P  E         p.60

          .         .         .         .         .         .       g.6437
 ATGCTCCTCTCGGAGGAGCGCCCTCCGCAGGAGGGTCTTTCCAGGAAGGACCTGTTTGAG       c.240
 M  L  L  S  E  E  R  P  P  Q  E  G  L  S  R  K  D  L  F  E         p.80

          .         .         .         .         .         .       g.6497
 GGGCGCCCTCCCATGGAGCAGCCTCCTTGTGGAGTAGGAAAACATAAGCTTGAAGAAGGA       c.300
 G  R  P  P  M  E  Q  P  P  C  G  V  G  K  H  K  L  E  E  G         p.100

          .         .         .         .         .         .       g.6557
 AGCTTTAAAGAAAGGTTGGCTCGTTCTCGCCCGCAATTTAGAGGGGACATACATGGCAGA       c.360
 S  F  K  E  R  L  A  R  S  R  P  Q  F  R  G  D  I  H  G  R         p.120

          .         .         .         .         .         .       g.6617
 AATTTAAGCAATGAGGAGATGATACAGGCAGCAGATGAGCTAGAAGAGATGAAAAGAGTA       c.420
 N  L  S  N  E  E  M  I  Q  A  A  D  E  L  E  E  M  K  R  V         p.140

          .         .         .         .         .         .       g.6677
 AGAAACAAACTGATGATAATGCACTGGAAGGCAAAACGGAGCCGTCCTTATCCTATTTAA       c.480
 R  N  K  L  M  I  M  H  W  K  A  K  R  S  R  P  Y  P  I  X         p.159

          .         .         .         .         .         .       g.6737
 tgtgttcggcctttaattctgttttgcctgctaatagtattgccattgccacctggactt       c.*60

          .         .         .         .         .         .       g.6797
 tctgtttgcattttcttaatgccttttcccatattctgaattttaactttttgtgaggct       c.*120

          .         .         .         .         .         .       g.6857
 ttattttagatgtttagcatgtaactcgcttaaagttgaggtttccccctaaaatctaca       c.*180

          .         .         .         .         .         .       g.6917
 agtttccctctttcagtcatgagccctacacatttgcatgaaagatgtacattatatatt       c.*240

          .         .         .         .         .         .       g.6977
 gtgaaacgaaaaaagcaattttcaaatggtatatattgtatcccatttttgtaaaaaaaa       c.*300

          .         .         .         .         .         .       g.7037
 tgtatatttatatattaatatgcaaagaaaaagctaaaagtatagacttcaaaggcataa       c.*360

          .         .         .         .         .         .       g.7097
 cagtggttgtgtggtaagataataggtgattttttaaatttttgttttatctgaatttct       c.*420

          .         .         .         .         .         .       g.7157
 cattttttcaggacaaacgttttacttgtgttgcaaaaatatataatgaaaaaatcacac       c.*480

          .         .         .         .         .         .       g.7217
 aattttgaagaaaactgtcaatcagcttataacgacaatgtggcacttaataaatacttg       c.*540

          .                                                         g.7234
 tcagaactttaaaaaaa                                                  c.*557

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Transcription elongation factor A (SII)-like 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.