trefoil factor 3 (intestinal) (TFF3) - coding DNA reference sequence

(used for variant description)

(last modified June 21, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_003226.3 in the TFF3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000021.8, covering TFF3 transcript NM_003226.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
 .         .         .         .         .         .                g.5060
 gccaaaacagtgggggctgaactgacctctcccctttgggagagaaaaactgtctgggag       c.-121

 .         .         .         .         .         .                g.5120
 cttgacaaaggcatgcaggagagaacaggagcagccacagccaggagggagagccttccc       c.-61

 .         .         .         .         .         .                g.5180
 caagcaaacaatccagagcagctgtgcaaacaacggtgcataaatgaggcctcctggacc       c.-1

          .         .         .         .         .         .       g.5240
 ATGAAGCGAGTCCTGAGCTGCGTCCCGGAGCCCACGGTGGTCATGGCTGCCAGAGCGCTC       c.60
 M  K  R  V  L  S  C  V  P  E  P  T  V  V  M  A  A  R  A  L         p.20

          .         .         .         .         .         .       g.5300
 TGCATGCTGGGGCTGGTCCTGGCCTTGCTGTCCTCCAGCTCTGCTGAGGAGTACGTGGGC       c.120
 C  M  L  G  L  V  L  A  L  L  S  S  S  S  A  E  E  Y  V  G         p.40

      | 02   .         .         .         .         .         .    g.7021
 CTGT | CTGCAAACCAGTGTGCCGTGCCAGCCAAGGACAGGGTGGACTGCGGCTACCCCCAT    c.180
 L  S |   A  N  Q  C  A  V  P  A  K  D  R  V  D  C  G  Y  P  H      p.60

          .         .         .         .         .         .       g.7081
 GTCACCCCCAAGGAGTGCAACAACCGGGGCTGCTGCTTTGACTCCAGGATCCCTGGAGTG       c.240
 V  T  P  K  E  C  N  N  R  G  C  C  F  D  S  R  I  P  G  V         p.80

          .         .         .  | 03      .                        g.8356
 CCTTGGTGTTTCAAGCCCCTGCAGGAAGCAG | AATGCACCTTCTGA                   c.285
 P  W  C  F  K  P  L  Q  E  A  E |   C  T  F  X                     p.94

          .         .         .         .         .         .       g.8416
 ggcacctccagctgcccccggccgggggatgcgaggctcggagcacccttgcccggctgt       c.*60

          .         .         .         .         .         .       g.8476
 gattgctgccaggcactgttcatctcagcttttctgtccctttgctcccggcaagcgctt       c.*120

          .         .         .         .         .         .       g.8536
 ctgctgaaagttcatatctggagcctgatgtcttaacgaataaaggtcccatgctccacc       c.*180

          .         .         .         .         .         .       g.8596
 cgaggacagttcttcgtgcctgagactttctgaggttgtgctttatttctgctgcgtcgt       c.*240

          .         .         .         .         .         .       g.8656
 gggagagggcgggagggtgtcaggggagagtctgcccaggcctcaagggcaggaaaagac       c.*300

          .         .         .         .         .         .       g.8716
 tccctaaggagctgcagtgcatgcaaggatattttgaatccagactggcacccacgtcac       c.*360

          .         .         .         .         .         .       g.8776
 aggaaagcctaggaacactgtaagtgccgcttcctcgggaaagcagaaaaaatacatttc       c.*420

          .         .         .         .         .         .       g.8836
 aggtagaagttttcaaaaatcacaagtctttcttggtgaagacagcaagccaataaaact       c.*480

          .         .         .         .         .         .       g.8896
 gtcttccaaagtggtcctttatttcacaaccactctcgctactgttcaatacttgtacta       c.*540

          .         .         .         .                           g.8945
 ttcctgggttttgtttctttgtacagtaaacattatgaacaaacaggca                  c.*589

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Trefoil factor 3 (intestinal) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.