THAP domain containing, apoptosis associated protein 1 (THAP1) - coding DNA reference sequence

(used for variant description)

(last modified October 20, 2021)

This file was created to facilitate the description of sequence variants on transcript NM_018105.2 in the THAP1 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000008.10, covering THAP1 transcript NM_018105.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5057
    gaggttgaagctgcctccgccatcttggagatgggagacgggcgatggctgtggtcc       c.-181

 .         .         .         .         .         .                g.5117
 ttctgctaatgcaaacaacaaaacgggcacactagtcacccccgagggaggccaccatca       c.-121

 .         .         .         .         .         .                g.5177
 ctgtaactgttggccaaagctacaaaagaagcgagggaatccaaccgagcgcagcgacac       c.-61

 .         .         .         .         .         .                g.5237
 tgagaacagcttcccctgccttctgcggcggcagaagtgaagtgcctgaggaccggaagg       c.-1

          .         .         .         .         .         .       g.5297
 ATGGTGCAGTCCTGCTCCGCCTACGGCTGCAAGAACCGCTACGACAAGGACAAGCCCGTT       c.60
 M  V  Q  S  C  S  A  Y  G  C  K  N  R  Y  D  K  D  K  P  V         p.20

          .  | 02      .         .         .         .         .    g.8999
 TCTTTCCACAA | GTTTCCTCTTACTCGACCCAGTCTTTGTAAAGAATGGGAGGCAGCTGTC    c.120
 S  F  H  K  |  F  P  L  T  R  P  S  L  C  K  E  W  E  A  A  V      p.40

          .         .         .         .         .         .       g.9059
 AGAAGAAAAAACTTTAAACCCACCAAGTATAGCAGTATTTGTTCAGAGCACTTTACTCCA       c.180
 R  R  K  N  F  K  P  T  K  Y  S  S  I  C  S  E  H  F  T  P         p.60

          .         .         .         .         .         .       g.9119
 GACTGCTTTAAGAGAGAGTGCAACAACAAGTTACTGAAAGAGAATGCTGTGCCCACAATA       c.240
 D  C  F  K  R  E  C  N  N  K  L  L  K  E  N  A  V  P  T  I         p.80

          .         .        | 03.         .         .         .    g.10028
 TTTCTTTGTACTGAGCCACATGACAAG | AAAGAAGATCTTCTGGAGCCACAGGAACAGCTT    c.300
 F  L  C  T  E  P  H  D  K   | K  E  D  L  L  E  P  Q  E  Q  L      p.100

          .         .         .         .         .         .       g.10088
 CCCCCACCTCCTTTACCGCCTCCTGTTTCCCAGGTTGATGCTGCTATTGGATTACTAATG       c.360
 P  P  P  P  L  P  P  P  V  S  Q  V  D  A  A  I  G  L  L  M         p.120

          .         .         .         .         .         .       g.10148
 CCGCCTCTTCAGACCCCTGTTAATCTCTCAGTTTTCTGTGACCACAACTATACTGTGGAG       c.420
 P  P  L  Q  T  P  V  N  L  S  V  F  C  D  H  N  Y  T  V  E         p.140

          .         .         .         .         .         .       g.10208
 GATACAATGCACCAGCGGAAAAGGATTCATCAGCTAGAACAGCAAGTTGAAAAACTCAGA       c.480
 D  T  M  H  Q  R  K  R  I  H  Q  L  E  Q  Q  V  E  K  L  R         p.160

          .         .         .         .         .         .       g.10268
 AAGAAGCTCAAGACCGCACAGCAGCGATGCAGAAGGCAAGAACGGCAGCTTGAAAAATTA       c.540
 K  K  L  K  T  A  Q  Q  R  C  R  R  Q  E  R  Q  L  E  K  L         p.180

          .         .         .         .         .         .       g.10328
 AAGGAGGTTGTTCACTTCCAGAAAGAGAAAGACGACGTATCAGAAAGAGGTTATGTGATT       c.600
 K  E  V  V  H  F  Q  K  E  K  D  D  V  S  E  R  G  Y  V  I         p.200

          .         .         .         .                           g.10370
 CTACCAAATGACTACTTTGAAATAGTTGAAGTACCAGCATAA                         c.642
 L  P  N  D  Y  F  E  I  V  E  V  P  A  X                           p.213

          .         .         .         .         .         .       g.10430
 aaaaatgaaatgtgtattgatttctaatggggcaataccacatatcctcctctagcctgt       c.*60

          .         .         .         .         .         .       g.10490
 aaaggagtttcatttaaaaaaataacatttgattacttatataaaaacagttcagaatat       c.*120

          .         .         .         .         .         .       g.10550
 ttttttaaaaaaaattctatatatactgtaaaattataaatttttttgtttgtaatttca       c.*180

          .         .         .         .         .         .       g.10610
 ggttttttacattttaacaaaatattttaaaagttataaactaacctcagacctctaatg       c.*240

          .         .         .         .         .         .       g.10670
 taagttggtttcaagattggggattttggggtttttttttagtatttatagaaataatgt       c.*300

          .         .         .         .         .         .       g.10730
 aaaaataaaaagtaaagagaatgagaacagtgtggtaaaagggtgatttcagtttaaaac       c.*360

          .         .         .         .         .         .       g.10790
 ttaaaattagtactgttttattgagagaatttagttatattttaaatcagaagtatgggt       c.*420

          .         .         .         .         .         .       g.10850
 cagatcatgggacataacttcttagaatatatatatacatatgtacatattctcatatgt       c.*480

          .         .         .         .         .         .       g.10910
 aaagtcacaaggttcatttatctttctgaatcagttatcaaagataaattggcaagtcag       c.*540

          .         .         .         .         .         .       g.10970
 tacttaagaaaaaagatttgattatcatcacagcagaaaaaagtcattgcatatctgatc       c.*600

          .         .         .         .         .         .       g.11030
 aataacttcagattctaagagtggattttttttttttacatgggctcctattttttcccc       c.*660

          .         .         .         .         .         .       g.11090
 tactgtcttgcattataaaattagaagtgtattttcagtggaagaaacatttttcaataa       c.*720

          .         .         .         .         .         .       g.11150
 ataaagtaaggcattgtcatcaatgaagtaattaaaactgggacctgatctatgatacgc       c.*780

          .         .         .         .         .         .       g.11210
 ttttttctttcattacaccctagctgaaggacatccagttccccagctgtagttatgtat       c.*840

          .         .         .         .         .         .       g.11270
 ctgccttcaagtctctgacaaatgtgctgtgttagtagagtttgatttgtatcatatgat       c.*900

          .         .         .         .         .         .       g.11330
 aatcttgcacttgactgagttgggacaaggcttcacataaaaaattatttcttcactttt       c.*960

          .         .         .         .         .         .       g.11390
 aacacaagttagaaattatatcccatttagttaagtgcgtgatttatattcagaacaacc       c.*1020

          .         .         .         .         .         .       g.11450
 tactatgtagcgtttattttactgaatgtggagatttaaacactgaggtttctgttcaaa       c.*1080

          .         .         .         .         .         .       g.11510
 ctgtgagttctgttctttgtgagaaattttacatatattggaagtgaaaatatgttctga       c.*1140

          .         .         .         .         .         .       g.11570
 gtaaacaaatattgctatgggagttatctttttagatttagaataactgttccaatgata       c.*1200

          .         .         .         .         .         .       g.11630
 attattacttttatatttcaaagtacactaagatcgttgaagagcaatagaacctttaag       c.*1260

          .         .                                               g.11658
 acagtattaaaggtgtgaaacaatggca                                       c.*1288

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The THAP domain containing, apoptosis associated protein 1 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.