translocase of inner mitochondrial membrane 17 homolog B (yeast) (TIMM17B) - coding DNA reference sequence

(used for variant description)

(last modified October 20, 2013)


This file was created to facilitate the description of sequence variants on transcript NM_005834.3 in the TIMM17B gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_015968.2, covering TIMM17B transcript NM_005834.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.5029
                                tgggggagcagagggcagcacttcctcca       c.-121

 .         .         .         .         .        | 02.             g.5334
 gctccaaaagagtgcacccaccccaacgttaccaatacactcgtgcag | gcggaaagctcc    c.-61

 .         .         .         .         .         .                g.5394
 gacgccggtgtgcgtctacgctgggggcgtggcctgactgcgcggccagacgccagcgcc       c.-1

          .         .       | 03 .         .         .         .    g.6319
 ATGGAGGAGTACGCTCGGGAGCCCTG | CCCATGGCGAATTGTGGATGATTGCGGTGGAGCC    c.60
 M  E  E  Y  A  R  E  P  C  |  P  W  R  I  V  D  D  C  G  G  A      p.20

          .         .         .         .         .         .       g.6379
 TTCACTATGGGTGTCATCGGTGGCGGAGTCTTCCAGGCCATCAAGGGTTTCCGCAATGCC       c.120
 F  T  M  G  V  I  G  G  G  V  F  Q  A  I  K  G  F  R  N  A         p.40

        | 04 .         .         .         .         .         .    g.8096
 CCTGTT | GGAATTCGGCACCGGTTGAGAGGTAGTGCCAATGCTGTGAGGATCCGAGCCCCC    c.180
 P  V   | G  I  R  H  R  L  R  G  S  A  N  A  V  R  I  R  A  P      p.60

          . | 05       .         .         .         .         .    g.8968
 CAGATTGGAG | GTAGCTTCGCAGTGTGGGGGGGCCTGTTCTCCACCATTGACTGTGGCCTG    c.240
 Q  I  G  G |   S  F  A  V  W  G  G  L  F  S  T  I  D  C  G  L      p.80

          .         .         .         .         .         .       g.9028
 GTGCGGCTTCGGGGCAAGGAGGATCCCTGGAACTCTATCACCAGTGGAGCATTGACCGGG       c.300
 V  R  L  R  G  K  E  D  P  W  N  S  I  T  S  G  A  L  T  G         p.100

          .          | 06        .         .         .         .    g.9174
 GCTGTGCTGGCTGCCCGCA | GTGGCCCACTGGCCATGGTGGGCTCAGCAATGATGGGGGGC    c.360
 A  V  L  A  A  R  S |   G  P  L  A  M  V  G  S  A  M  M  G  G      p.120

          .         .         .         .         .         .       g.9234
 ATCCTGTTGGCCCTCATTGAGGGCGTTGGCATCCTCCTCACTCGCTACACAGCCCAGCAG       c.420
 I  L  L  A  L  I  E  G  V  G  I  L  L  T  R  Y  T  A  Q  Q         p.140

          . | 07       .         .         .         .         .    g.9376
 TTCCGAAATG | CGCCCCCATTCCTGGAGGACCCCAGCCAGCTGCCCCCTAAGGATGGCACC    c.480
 F  R  N  A |   P  P  F  L  E  D  P  S  Q  L  P  P  K  D  G  T      p.160

          .         .         .                                     g.9415
 CCGGCCCCAGGCTACCCCAGCTATCAGCAGTACCACTGA                            c.519
 P  A  P  G  Y  P  S  Y  Q  Q  Y  H  X                              p.172

          .         .         .         .         .         .       g.9475
 ggaagccactgccaccatgggagctacttctcggttccctccccgatggtctacctcgaa       c.*60

          .         .         .         .         .         .       g.9535
 gggagggctggctcccagttagccctgggaccctccagagagggtttctactctgctccc       c.*120

          .         .         .         .         .         .       g.9595
 tagtcccagggtgggggtggggcaccccagctgccctgacagatgggtcccctttttctc       c.*180

          .         .         .         .         .         .       g.9655
 tctcagggcaccccagccccacactcacatgtacgaagttctcaccccagctcctttgtg       c.*240

          .         .         .         .                           g.9697
 tggcaccctgatgagtatttaaagcccgttttgaaatgccta                         c.*282

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Translocase of inner mitochondrial membrane 17 homolog B (yeast) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 08
©2004-2013 Leiden University Medical Center