translocase of inner mitochondrial membrane 8 homolog A (yeast) (TIMM8A) - coding DNA reference sequence

(used for variant description)

(last modified August 22, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_004085.3 in the TIMM8A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_011734.1, covering TIMM8A transcript NM_004085.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                                    g.5005
                                                        atctc       c.-301

 .         .         .         .         .         .                g.5065
 aacggcacctcggctctgggctgtaagccctgcgatctcaaggcgcaaggctgggcgcaa       c.-241

 .         .         .         .         .         .                g.5125
 cggcagggttgcggggttacgggattgcggggtccggggagtggaacccgccgactccgg       c.-181

 .         .         .         .         .         .                g.5185
 gaacgaagcaccggcgccaaggtgtgggaggcggcggggtggagttggacgcctgcctcg       c.-121

 .         .         .         .         .         .                g.5245
 cgccgacgcagtgcactcacgggggcggtcccagaggcagctagctgtggttccggttcc       c.-61

 .         .         .         .         .         .                g.5305
 gtcgcggagacacgtgaaggtcggtgcggagttcgtctctgcaagcttggtcgccctggg       c.-1

          .         .         .         .         .         .       g.5365
 ATGGATTCCTCCTCCTCTTCCTCCGCGGCGGGTTTGGGTGCAGTGGACCCGCAGTTGCAG       c.60
 M  D  S  S  S  S  S  S  A  A  G  L  G  A  V  D  P  Q  L  Q         p.20

          .         .         .         .         .         .       g.5425
 CATTTCATCGAGGTAGAGACTCAAAAGCAGCGCTTCCAGCAGCTGGTGCACCAGATGACT       c.120
 H  F  I  E  V  E  T  Q  K  Q  R  F  Q  Q  L  V  H  Q  M  T         p.40

          .   | 02     .         .         .         .         .    g.7357
 GAACTTTGTTGG | GAGAAGTGCATGGACAAGCCTGGGCCAAAGTTGGACAGTCGGGCTGAG    c.180
 E  L  C  W   | E  K  C  M  D  K  P  G  P  K  L  D  S  R  A  E      p.60

          .         .         .         .         .         .       g.7417
 GCCTGTTTTGTGAACTGCGTTGAGCGCTTCATTGATACAAGCCAGTTCATCTTGAATCGA       c.240
 A  C  F  V  N  C  V  E  R  F  I  D  T  S  Q  F  I  L  N  R         p.80

          .         .         .         .         .                 g.7471
 CTGGAACAGACCCAGAAATCCAAGCCAGTTTTCTCAGAAAGCCTTTCTGACTGA             c.294
 L  E  Q  T  Q  K  S  K  P  V  F  S  E  S  L  S  D  X               p.97

          .         .         .         .         .         .       g.7531
 tctcagcattacctctttggaaaaggaaggtagttcaagaaatgaagagctgttgatggg       c.*60

          .         .         .         .         .         .       g.7591
 atgattgaagaaacagctatgagaggattggctcccatcttttgttactcttgggacatc       c.*120

          .         .         .         .         .         .       g.7651
 ctgtcatctgagaatgaacaaagaccaattttttgtgtgtgaagcttaagggtcatatgt       c.*180

          .         .         .         .         .         .       g.7711
 ttgcttgtattttttaatgctaatcttgtgaaaataattgacaggcgaaagaaaactcta       c.*240

          .         .         .         .         .         .       g.7771
 tttagatgcatattactgtacatgggactatgcttttctcaaagccccattaactgcttc       c.*300

          .         .         .         .         .         .       g.7831
 ctataattttgatagtgggaccacatacgtaaaaatctctcatttgtgtggagtcatttc       c.*360

          .         .         .         .         .         .       g.7891
 tgatttcaggggagatccttgtgtttatcagaaagggcagaagtaggggaagaataattt       c.*420

          .         .         .         .         .         .       g.7951
 ggtatccttatctagtgtttgattgtcaatgctggagaaaaatatctgtaagagtgttta       c.*480

          .         .         .         .         .         .       g.8011
 tacagtacacttcagttatcttgatctccctttcctatatgatgatttgcttaaatatcc       c.*540

          .         .         .         .         .         .       g.8071
 atattaagtaagtctcaaggtagggtaggcagcctgagagtctagaggcctttagttata       c.*600

          .         .         .         .         .         .       g.8131
 aaggaatctagccagtgaacataattcttattactagactgccacaaggaagaaattaac       c.*660

          .         .         .         .         .         .       g.8191
 ttaccctgtatatcagggtacaaaaaattcagtgatgtgcctaaataagttataaagatt       c.*720

          .         .         .         .         .         .       g.8251
 taggccaatcagaagctaacagcagtttcaggtagaggtgcatgcctaatgttagttagt       c.*780

          .         .         .         .         .         .       g.8311
 gtagattccatttactgcattcttctgatcactgaaataaaagctatataagattcaact       c.*840

                                                                    g.8314
 ctg                                                                c.*843

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Translocase of inner mitochondrial membrane 8 homolog A (yeast) protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.