thymidine kinase 2, mitochondrial (TK2) - coding DNA reference sequence

(used for variant description)

(last modified February 2, 2014)


This file was created to facilitate the description of sequence variants on transcript NM_001172643.1 in the TK2 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000016.9, covering TK2 transcript NM_001172643.1.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                                    g.5129
                                                     gccaagtt       c.-1

          .         .         .  | 02      .         .         .    g.6432
 ATGGGTGCGTTCTGCCAGCGTCCTAGCAGTG | ATAAAGAACAGGAAAAAGAGAAAAAATCA    c.60
 M  G  A  F  C  Q  R  P  S  S  D |   K  E  Q  E  K  E  K  K  S      p.20

     | 03    .         .         .         .         .         .    g.13516
 GTG | ATCTGTGTCGAGGGCAATATTGCAAGTGGGAAGACGACATGCCTGGAATTCTTCTCC    c.120
 V   | I  C  V  E  G  N  I  A  S  G  K  T  T  C  L  E  F  F  S      p.40

          .         | 04         .         .         .         .    g.18437
 AACGCGACAGACGTCGAG | GTGTTAACGGAGCCTGTGTCCAAGTGGAGAAATGTCCGTGGC    c.180
 N  A  T  D  V  E   | V  L  T  E  P  V  S  K  W  R  N  V  R  G      p.60

          .   | 05     .         .         .         .         .    g.23991
 CACAATCCTCTG | GGCCTGATGTACCACGATGCCTCTCGCTGGGGTCTTACGCTACAGACT    c.240
 H  N  P  L   | G  L  M  Y  H  D  A  S  R  W  G  L  T  L  Q  T      p.80

          .         .         .         .   | 06     .         .    g.26363
 TATGTGCAGCTCACCATGCTGGACAGGCATACTCGTCCTCAG | GTGTCATCTGTACGGTTG    c.300
 Y  V  Q  L  T  M  L  D  R  H  T  R  P  Q   | V  S  S  V  R  L      p.100

          .         .         .         .         .       | 07 .    g.37539
 ATGGAGAGGTCGATTCACAGCGCAAGATACATTTTTGTAGAAAACCTGTATAGAAG | TGGG    c.360
 M  E  R  S  I  H  S  A  R  Y  I  F  V  E  N  L  Y  R  S  |  G      p.120

          .         .         .         .         .         .       g.37599
 AAGATGCCAGAAGTGGACTATGTAGTTCTGTCGGAATGGTTTGACTGGATCTTGAGGAAC       c.420
 K  M  P  E  V  D  Y  V  V  L  S  E  W  F  D  W  I  L  R  N         p.140

          .         .      | 08  .         .         .         .    g.38232
 ATGGACGTGTCTGTTGATTTGATAG | TTTACCTTCGGACCAATCCTGAGACTTGTTACCAG    c.480
 M  D  V  S  V  D  L  I  V |   Y  L  R  T  N  P  E  T  C  Y  Q      p.160

          .         .         .         .      | 09  .         .    g.41616
 AGGTTAAAGAAGAGATGCAGGGAAGAGGAGAAGGTCATTCCGCTG | GAATACCTGGAAGCA    c.540
 R  L  K  K  R  C  R  E  E  E  K  V  I  P  L   | E  Y  L  E  A      p.180

          .         .         .         .         .         .       g.41676
 ATTCACCATCTCCATGAGGAGTGGCTCATCAAAGGCAGCCTTTTCCCCATGGCAGCCCCT       c.600
 I  H  H  L  H  E  E  W  L  I  K  G  S  L  F  P  M  A  A  P         p.200

        | 10 .         .         .         .         .         .    g.43400
 GTTCTG | GTGATTGAGGCTGACCACCACATGGAGAGGATGTTAGAACTCTTTGAACAAAAT    c.660
 V  L   | V  I  E  A  D  H  H  M  E  R  M  L  E  L  F  E  Q  N      p.220

          .         .         .         .                           g.43445
 CGGGATCGAATATTAACTCCAGAGAATCGGAAGCATTGCCCATAG                      c.705
 R  D  R  I  L  T  P  E  N  R  K  H  C  P  X                        p.234

          .         .         .         .         .         .       g.43505
 gaggcaaaaggtctatggctcatgtctgaaaaatgcctgctgctgccaagttagctattg       c.*60

          .         .         .         .         .         .       g.43565
 ggagcaatctggaaaaacttgctcccaggagggctttgtgtctggccagcttgattttcc       c.*120

          .         .         .         .         .         .       g.43625
 taatggtctcatctcctttgctagtgtctttgtcatgcgtctctggccctcgtgggtaaa       c.*180

          .         .         .         .         .         .       g.43685
 tgacaaacgggaccaatgggtttgccaagccctttgctgttcgcagcctcacattccccc       c.*240

          .         .         .         .         .         .       g.43745
 ggtgcctctcccatggctttgtgctgctgagtcgctctcatgaagcccttagggagagca       c.*300

          .         .         .         .         .         .       g.43805
 cctgttgtgtgcctgacaccacgctggagctgtgtaccaatcgtctcagccttcattagg       c.*360

          .         .         .         .         .         .       g.43865
 aggccgaggtaggagtcttatatcccaggtgaggaatttgaagctcagaaaggttgaggg       c.*420

          .         .         .         .         .         .       g.43925
 gctccccagaggtcacacagcctgtgtgcagtggagctggcaccattcagactttcagcc       c.*480

          .         .         .         .         .         .       g.43985
 gactcagcaactttcccttgccctgggctgcctcctcctgagagctgttccccaccgccc       c.*540

          .         .         .         .         .         .       g.44045
 tgcctcttccggttggaggctctcatgtctctttggggagagctggcagtgtgcggagct       c.*600

          .         .         .         .         .         .       g.44105
 gataacattttcccaatattgagcagttcccaaggacagtcagcatttctagacttccac       c.*660

          .         .         .         .         .         .       g.44165
 aaaattatgctgcatttggctggagcccggtgttcagtggtttccctgcccgaggtcgct       c.*720

          .         .         .         .         .         .       g.44225
 gcagccccatctaccacatcttcatgtggacattgagattcacatgctggctcctgaagg       c.*780

          .         .         .         .         .         .       g.44285
 gtgctcagtctccttggtgattaaggtcctgcttgaactgctgccaactccatgtcaggg       c.*840

          .         .         .         .         .         .       g.44345
 aagtcgcttttggtgcctggctggtttgcccagagccaagctggggcaaggggcagccag       c.*900

          .         .         .         .         .         .       g.44405
 ccctggcttccaaggctcccgtactgtctgtgtccttgtataaggagctttgctcttgga       c.*960

          .         .         .         .         .         .       g.44465
 attactgaaagtctgtggcccaagagagagacacaagtggccttaagtctttttgaagtg       c.*1020

          .         .         .         .         .         .       g.44525
 ttatttcatccagggaaatgcctcgagccatagagcctgaaatcatctttgttggctcag       c.*1080

          .         .         .         .         .         .       g.44585
 aaaataccttagcttcactcagctggactgcattgaaggcgaggctgccccttggatcaa       c.*1140

          .         .         .         .         .         .       g.44645
 gcagaaaacaagagaaagaaagaacgttccctttggggatagtctggaaagttgggattt       c.*1200

          .         .         .         .         .         .       g.44705
 gcaaataaaggctctggaagcattgctggtcctgaagctttggaggtgggcagagagagc       c.*1260

          .         .         .         .         .         .       g.44765
 ttcaagaagactagatgcaaaccctggaaaggattaaggctcaactctggagaaacaggc       c.*1320

          .         .         .         .         .         .       g.44825
 cacagcctctcagagcagctgttggctgtaaatagaggtagcaaggccgctcccaggccc       c.*1380

          .         .         .         .         .         .       g.44885
 ctgtgagtgtgggcacctgtgcatgcaatgctccgactctgcagaggtgccaagtgcccc       c.*1440

          .         .         .         .         .         .       g.44945
 tgctgggccagtcccagagagttaggaagtcaaggcctgcaactcctggttcttcctgtt       c.*1500

          .         .         .         .         .         .       g.45005
 tggaccagttcttgtgccattggcaggatgagaggcagcagccaggcgggagctgtgtct       c.*1560

          .         .         .         .         .         .       g.45065
 agcagcacctgtagcccacgtgctgctaattagctggaaaactggcgaaggcagaacctt       c.*1620

          .         .         .         .         .         .       g.45125
 tgctaccaggaatcttgacatgtggggtctgtctttgagaatttgtaaatgaacagtcca       c.*1680

          .         .         .         .         .         .       g.45185
 atatttcctctcggctcattttgcacatccatttttggggaaatgtgatttctctctctt       c.*1740

          .         .         .         .         .         .       g.45245
 tttttttttttttttttgcctaaggcacaatctcaagaggtcctgagaccacgtacccat       c.*1800

          .         .         .         .         .         .       g.45305
 gatttttttcttgctctgtgatacccaataactccttcacctaagccctgttgttgattt       c.*1860

          .         .         .         .         .         .       g.45365
 tgaagtgcttcctaggccagtgattttagcttctgccagctgcttttgccagtagattaa       c.*1920

          .         .         .         .         .         .       g.45425
 cgtgtttttatttttcaaactccgtgtttcctaacgtggagtgtatgggtctaagagagc       c.*1980

          .         .         .         .         .         .       g.45485
 ctgctgtcctccctgccttccaccttggagaggaggctggacgcatcagcagtggccagg       c.*2040

          .         .         .         .         .         .       g.45545
 gcaggtcgcaaaatctcccagcctagagaccacacctgaaacggctgaagccagcttgca       c.*2100

          .         .         .         .         .         .       g.45605
 caagggctgctgtccctctgcggcaggcagagctggtgggggcaggggtcacagagcagt       c.*2160

          .         .         .         .         .         .       g.45665
 catagacaccatggaccagggcaggagaagggcagatggcacatgggcacaacagggcct       c.*2220

          .         .         .         .         .         .       g.45725
 tgtccttagagcactggggggtcatggctgggaggggcatggcaggggctggcatccctg       c.*2280

          .         .         .         .         .         .       g.45785
 tagagccagaggggccacccagggcagtgacattccagatatgttgggctcacctcatcc       c.*2340

          .         .         .         .         .         .       g.45845
 ttgctgtgagactggagttccatggggacatgaagtcagtacaccgcagagctgctcagc       c.*2400

          .         .         .         .         .         .       g.45905
 tgctctacctctcgctgacttttttgttgcacatatacattttctttcaattagcattta       c.*2460

          .         .         .         .         .         .       g.45965
 tttcagcttttatttaagctttttgacagtacatgtaaaatatatgattataaccattta       c.*2520

          .         .         .         .         .         .       g.46025
 aaaataccttatgtacctggttttttttggaaactagatagaaatatatttatcttttac       c.*2580

          .         .         .         .         .         .       g.46085
 ataaaagaagtgtgtagtggggtggtccagggctttgtggtggcttagtggccatcgggg       c.*2640

          .         .         .         .         .         .       g.46145
 tcccaggctcttcccacctttctcttttgggtccacctcttggctcctggcttccttcct       c.*2700

          .         .         .         .         .         .       g.46205
 ctggggcctgactgtccaggatggcagctggagctcctgctctgggcacggttggcatca       c.*2760

          .         .         .         .         .         .       g.46265
 gagcccactgctccccatccactctttaatccagatgctggtaatgtccctttccaaggc       c.*2820

          .         .         .         .         .         .       g.46325
 ataactaagataagctggaaggttcttacgaggctttgctagaggccctgggaggtgggg       c.*2880

          .         .         .         .         .         .       g.46385
 ggaaaggcaagagggcagtgcccacccatagaccgggtcacatgacctggcatcagcgcc       c.*2940

          .         .         .         .         .         .       g.46445
 gtggggtcctttgggcttcacctccctctcccctctgcccccacgtcatcccaccctcat       c.*3000

          .         .         .         .         .         .       g.46505
 cctcaccctcaccattcccatcccgtaccgtaatgtcccttgcaaggcctaactctgtga       c.*3060

          .         .         .         .         .         .       g.46565
 ggaatgaaaccacctcatccttgttccaataacatgagtgaccgaatttacaaacgagtg       c.*3120

          .         .         .         .         .         .       g.46625
 aatgtggacctctggaaacattacccagcttgtttttacttttcactttctctttctgcc       c.*3180

          .         .         .         .         .         .       g.46685
 cctttcatttccgtaggagccctttacctagatgagaagtgtccccccgcctggggaata       c.*3240

          .         .         .         .         .         .       g.46745
 tatcagtcagaacaatcttcctgcagacatgcaccattagacccgagtgacggtggtgcc       c.*3300

          .         .         .         .         .         .       g.46805
 atttaaacctcagagcaggtaaaaggtggtcctgaaacctgtctacccacagggtgctat       c.*3360

          .         .         .         .         .         .       g.46865
 ggaatctgaatcacttcttttttcctagagccctggggtggggagctccctcaagtgttc       c.*3420

          .         .         .         .         .         .       g.46925
 acatgtgtgtggaatgaggaacacccatctccttggccctctccaccctgaagagttagt       c.*3480

          .         .         .         .         .         .       g.46985
 tattaaaataattggcaagctcttgcaaatgtcagtcatccattgttcagaatggaatag       c.*3540

          .         .         .         .         .         .       g.47045
 caataatacatccctggctgccctgggcttggccaggattactcactgaaggcctcaggg       c.*3600

          .         .         .         .         .         .       g.47105
 ttactggcacacactttcttttcctaataatcccatcccctcagctttcctaaggctaga       c.*3660

          .         .         .         .         .         .       g.47165
 gtgaatttcgtgttcctttagtttacataagatggtgaacttggcaaaagctatcattaa       c.*3720

          .         .         .         .         .         .       g.47225
 acagaagctaagagaaagcctatgtcgtggaatccagaatgggtattgccattcactgct       c.*3780

          .         .         .         .         .         .       g.47285
 gtccacagaagctgtcttgaatttctttctgtgtcttttctttttttttctttaagactg       c.*3840

          .         .         .         .         .         .       g.47345
 ttgtttaccagactgggctctgtggaacacaggtgtcctgggagatggttaatcattaca       c.*3900

          .         .         .         .         .         .       g.47405
 aaatattggtaacaatctaaagatgcatacataagagagtggtcaaataaaccattttcc       c.*3960

                                                                    g.47410
 attca                                                              c.*3965

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Thymidine kinase 2, mitochondrial protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 09
©2004-2014 Leiden University Medical Center