transketolase (TKT) - coding DNA reference sequence

(used for variant description)

(last modified February 1, 2019)


This file was created to facilitate the description of sequence variants on transcript NM_001064.3 in the TKT gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_027815.1, covering TKT transcript NM_001064.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5052
         gatccgagccccgcctcctccccctgccccgcctctcccatccccgccccgc       c.-121

 .         .         .         .         .         .                g.5112
 cccgcccggcgacttaacgcgcccccgccccgcgcccggcctcggcagccgcctgtcgcc       c.-61

 .         .         .         .         .         .                g.5172
 gcgggagcagccgctatctctgtgtgtccgcgtgtgcgcccggtccccgcctgccgcacc       c.-1

          .         .         .         .         .         .       g.5232
 ATGGAGAGCTACCACAAGCCTGACCAGCAGAAGCTGCAGGCCTTGAAGGACACGGCCAAC       c.60
 M  E  S  Y  H  K  P  D  Q  Q  K  L  Q  A  L  K  D  T  A  N         p.20

          .         .         .         .        | 02.         .    g.18885
 CGCCTACGTATCAGCTCCATCCAGGCCACCACTGCGGCGGGCTCTGG | CCACCCCACGTCA    c.120
 R  L  R  I  S  S  I  Q  A  T  T  A  A  G  S  G  |  H  P  T  S      p.40

          .         .         .         .         .         .       g.18945
 TGCTGCAGCGCCGCAGAGATCATGGCTGTCCTCTTTTTCCACACCATGCGCTACAAGTCC       c.180
 C  C  S  A  A  E  I  M  A  V  L  F  F  H  T  M  R  Y  K  S         p.60

          .         .         .         .      | 03  .         .    g.19884
 CAGGACCCCCGGAATCCGCACAATGACCGCTTTGTGCTCTCCAAG | GGCCATGCAGCTCCC    c.240
 Q  D  P  R  N  P  H  N  D  R  F  V  L  S  K   | G  H  A  A  P      p.80

          .         .         .         .         .         .       g.19944
 ATCCTCTACGCGGTCTGGGCTGAAGCTGGTTTCCTGGCCGAGGCGGAGCTGCTGAACCTG       c.300
 I  L  Y  A  V  W  A  E  A  G  F  L  A  E  A  E  L  L  N  L         p.100

          .         .         .          | 04        .         .    g.20787
 AGGAAGATCAGCTCCGACTTGGACGGGCACCCGGTCCCG | AAACAAGCTTTCACCGACGTG    c.360
 R  K  I  S  S  D  L  D  G  H  P  V  P   | K  Q  A  F  T  D  V      p.120

          .         .         .         .         .         .       g.20847
 GCCACTGGCTCCCTGGGCCAGGGCCTCGGGGCCGCTTGTGGGATGGCCTACACCGGCAAA       c.420
 A  T  G  S  L  G  Q  G  L  G  A  A  C  G  M  A  Y  T  G  K         p.140

          .        | 05.         .         .         .         .    g.25983
 TACTTCGACAAGGCCAG | CTACCGAGTCTATTGCTTGCTGGGAGACGGGGAGCTGTCAGAG    c.480
 Y  F  D  K  A  S  |  Y  R  V  Y  C  L  L  G  D  G  E  L  S  E      p.160

          .         .         .         .         .         .       g.26043
 GGCTCTGTATGGGAGGCCATGGCCTTCGCCAGCATCTATAAGCTGGACAACCTTGTGGCC       c.540
 G  S  V  W  E  A  M  A  F  A  S  I  Y  K  L  D  N  L  V  A         p.180

          .         .         .         .         .         .       g.26103
 ATTCTAGACATCAATCGCCTGGGCCAGAGTGACCCGGCCCCACTGCAGCACCAGATGGAC       c.600
 I  L  D  I  N  R  L  G  Q  S  D  P  A  P  L  Q  H  Q  M  D         p.200

          .         .          | 06        .         .         .    g.27871
 ATCTACCAGAAGCGGTGCGAGGCCTTCGG | TTGGCATGCCATCATCGTGGATGGACACAGC    c.660
 I  Y  Q  K  R  C  E  A  F  G  |  W  H  A  I  I  V  D  G  H  S      p.220

          .         .         .         .         .         .       g.27931
 GTGGAGGAGCTGTGCAAGGCCTTTGGCCAGGCCAAGCACCAGCCAACAGCCATCATTGCC       c.720
 V  E  E  L  C  K  A  F  G  Q  A  K  H  Q  P  T  A  I  I  A         p.240

          .         .         | 07         .         .         .    g.29596
 AAGACCTTCAAGGGCCGAGGGATCACGG | GGGTAGAAGATAAGGAGTCTTGGCATGGGAAG    c.780
 K  T  F  K  G  R  G  I  T  G |   V  E  D  K  E  S  W  H  G  K      p.260

          .         .         .         .         .         .       g.29656
 CCCCTCCCCAAAAACATGGCTGAGCAGATCATCCAGGAGATCTACAGCCAGATCCAGAGC       c.840
 P  L  P  K  N  M  A  E  Q  I  I  Q  E  I  Y  S  Q  I  Q  S         p.280

          .         .         .         .         .         .       g.29716
 AAAAAGAAGATCCTGGCAACCCCTCCACAGGAGGACGCACCCTCAGTGGACATTGCCAAC       c.900
 K  K  K  I  L  A  T  P  P  Q  E  D  A  P  S  V  D  I  A  N         p.300

          .         .         .         .   | 08     .         .    g.30511
 ATCCGCATGCCCAGCCTGCCCAGCTACAAAGTTGGGGACAAG | ATAGCCACCCGCAAGGCC    c.960
 I  R  M  P  S  L  P  S  Y  K  V  G  D  K   | I  A  T  R  K  A      p.320

          .         .         .         .         .         .       g.30571
 TACGGGCAGGCACTGGCCAAGCTGGGCCATGCCAGTGACCGCATCATCGCCCTGGATGGG       c.1020
 Y  G  Q  A  L  A  K  L  G  H  A  S  D  R  I  I  A  L  D  G         p.340

          .         .         .         .         .         .       g.30631
 GACACCAAAAATTCCACCTTCTCGGAGATCTTCAAAAAGGAGCACCCGGACCGCTTCATC       c.1080
 D  T  K  N  S  T  F  S  E  I  F  K  K  E  H  P  D  R  F  I         p.360

          .         .        | 09.         .         .         .    g.31711
 GAGTGCTACATTGCTGAGCAGAACATG | GTGAGCATCGCGGTGGGCTGTGCCACCCGCAAC    c.1140
 E  C  Y  I  A  E  Q  N  M   | V  S  I  A  V  G  C  A  T  R  N      p.380

          .         .         .         .         .         .       g.31771
 AGGACGGTGCCCTTCTGCAGCACTTTTGCAGCCTTCTTCACGCGGGCCTTTGACCAGATT       c.1200
 R  T  V  P  F  C  S  T  F  A  A  F  F  T  R  A  F  D  Q  I         p.400

          .         .         .         .         .         .       g.31831
 CGCATGGCCGCCATCTCCGAGAGCAACATCAACCTCTGCGGCTCCCACTGCGGCGTTTCC       c.1260
 R  M  A  A  I  S  E  S  N  I  N  L  C  G  S  H  C  G  V  S         p.420

      | 10   .         .         .         .         .         .    g.32033
 ATCG | GGGAAGACGGGCCCTCCCAGATGGCCCTAGAAGATCTGGCTATGTTTCGGTCAGTC    c.1320
 I  G |   E  D  G  P  S  Q  M  A  L  E  D  L  A  M  F  R  S  V      p.440

          .         .         .         .         .         .       g.32093
 CCCACATCAACTGTCTTTTACCCAAGTGATGGCGTTGCTACAGAGAAGGCAGTGGAACTA       c.1380
 P  T  S  T  V  F  Y  P  S  D  G  V  A  T  E  K  A  V  E  L         p.460

          .      | 11  .         .         .         .         .    g.32800
 GCCGCCAATACAAAG | GGTATCTGCTTCATCCGGACCAGCCGCCCAGAAAATGCCATCATC    c.1440
 A  A  N  T  K   | G  I  C  F  I  R  T  S  R  P  E  N  A  I  I      p.480

          .         .         .          | 12        .         .    g.32986
 TATAACAACAATGAGGACTTCCAGGTCGGACAAGCCAAG | GTGGTCCTGAAGAGCAAGGAT    c.1500
 Y  N  N  N  E  D  F  Q  V  G  Q  A  K   | V  V  L  K  S  K  D      p.500

          .         .         .         .         .         .       g.33046
 GACCAGGTGACCGTTATCGGGGCTGGGGTGACCCTGCACGAGGCCTTGGCCGCTGCCGAA       c.1560
 D  Q  V  T  V  I  G  A  G  V  T  L  H  E  A  L  A  A  A  E         p.520

          .    | 13    .         .         .         .         .    g.34283
 CTGCTGAAGAAAG | AAAAGATCAACATCCGCGTGCTGGACCCCTTCACCATCAAGCCCCTG    c.1620
 L  L  K  K  E |   K  I  N  I  R  V  L  D  P  F  T  I  K  P  L      p.540

          .         .         .         .         .         .       g.34343
 GACAGAAAACTCATTCTCGACAGCGCTCGTGCCACCAAGGGCAGGATCCTCACCGTGGAG       c.1680
 D  R  K  L  I  L  D  S  A  R  A  T  K  G  R  I  L  T  V  E         p.560

          .       | 14 .         .         .         .         .    g.35227
 GACCATTATTATGAAG | GTGGCATTGGTGAGGCTGTGTCCAGTGCAGTAGTGGGCGAGCCT    c.1740
 D  H  Y  Y  E  G |   G  I  G  E  A  V  S  S  A  V  V  G  E  P      p.580

          .         .         .         .         .         .       g.35287
 GGCATCACTGTCACCCACCTGGCAGTTAACCGGGTACCAAGAAGTGGGAAGCCGGCTGAG       c.1800
 G  I  T  V  T  H  L  A  V  N  R  V  P  R  S  G  K  P  A  E         p.600

          .         .         .         .         .         .       g.35347
 CTGCTGAAGATGTTTGGTATCGACAGGGATGCCATTGCACAAGCTGTGAGGGGCCTCATC       c.1860
 L  L  K  M  F  G  I  D  R  D  A  I  A  Q  A  V  R  G  L  I         p.620

          .                                                         g.35359
 ACCAAGGCCTAG                                                       c.1872
 T  K  A  X                                                         p.623

          .         .         .         .         .         .       g.35419
 ggcgggtatgaagtgtggggcgggggtctatacattcctgagattctgggaaaggtgctc       c.*60

          .         .         .         .         .         .       g.35479
 aaagatgtactgagaggaggggtaaatatatgttttgagaaaaatgaattggccctgaaa       c.*120

 

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Transketolase protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 21b
©2004-2019 Leiden University Medical Center