transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila) (TLE6) - 587 nt intron 01 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.5133
gtgagggacgtgagttgccaggcgtgttctagggggctggggggactccaggattcccgg  c.-37+60

         .         .         .         .         .         .  g.5193
ccggggaaggggctgcaggggcgtggaggggcaggactgaggcaaggaagaagctgggtg  c.-37+120

         .         .         .         .         .         .  g.5253
ctgcagcagggatggaggtggagagaggtcgtttcttctgtctgatgaattccgcctaat  c.-37+180

         .         .         .         .         .         .  g.5313
gcacctggctaactcctagtcatccttcaaaacccctttctagtgatctccctgcgcttt  c.-37+240

         .         .         .         .         .      g.5367
aggaaattgtctcaaaactaaggttgagctttggcgaccttccctgggctcccc  c.-37+294

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.5420
       cgtccctgactgcccccagcagggagtgtatgtgcactatccaccccagcctc  c.-36-241

.         .         .         .         .         .           g.5480
ctagggtgaggcctgggaggcaaggctcagttctttctgggtccccgcccccatgaatct  c.-36-181

.         .         .         .         .         .           g.5540
gggcagctggaggcattgataagtgaggacaggacctagggaacgcatgggagaaccgca  c.-36-121

.         .         .         .         .         .           g.5600
ggattgggtccctggagacttaccaaactgggaggtgcgggtggggtaacgggtgccttg  c.-36-61

.         .         .         .         .         .           g.5660
cttccctggcactgccttattttctgtccctcaagacctgccgtctccttgttgttttag  c.-36-1


Powered by LOVD v.3.0 Build 30b
©2004-2024 Leiden University Medical Center