transducin-like enhancer of split 6 (E(sp1) homolog, Drosophila) (TLE6) - 351 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .  g.14895
gtgagtaaacaacctcagctctatccagaggggtgggcttccgggcaggcggttgggctc  c.558+60

         .         .         .         .         .         .  g.14955
ccccaggtcagggcactggggttcctgtgggatttgtcttccttccatcctgcccctcgg  c.558+120

         .         .         .         .         .        g.15011
gtcccccgggggggacttgggtgatccaggaggctatactggagtagcccaggacc  c.558+176

--------------------- middle of intron ---------------------
          .         .         .         .         .           g.15066
     cacagcccagggcttccaggaccctataccctgactctctctctgcaactctgcc  c.559-121

.         .         .         .         .         .           g.15126
tggacccgcagacaggaccccaggcagctgacaagccctgtgcaagctgcccaggaatcc  c.559-61

.         .         .         .         .         .           g.15186
gaggtcttctggtcctaacaggcaggtcagcaggcctgatgagacttttccattttccag  c.559-1


Powered by LOVD v.3.0 Build 30b
©2004-2024 Leiden University Medical Center