transmembrane 4 L six family member 19 (TM4SF19) - coding DNA reference sequence

(used for variant description)

(last modified April 9, 2022)

This file was created to facilitate the description of sequence variants on transcript NM_138461.3 in the TM4SF19 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000003.11, covering TM4SF19 transcript NM_138461.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5038
                       acgtatatacagagcctccctggccctcctggaaagag       c.-121

 .         .         .         .         .         .                g.5098
 tcctggaaagacaaccttcaggtccagccctggagctggaggagtggagccccactctga       c.-61

 .         .         .         .         .         .         | 02    g.15830
 agacgcagcctttctccaggttctgtctctcccattctgattcttgacaccagatgcag | g    c.-1

          .         .         .         .         .         .       g.15890
 ATGGTGTCCTCTCCCTGCACGCAGGCAAGCTCACGGACTTGCTCCCGTATCCTGGGACTG       c.60
 M  V  S  S  P  C  T  Q  A  S  S  R  T  C  S  R  I  L  G  L         p.20

          .         .         .         .         .         .       g.15950
 AGCCTTGGGACTGCAGCCCTGTTTGCTGCTGGGGCCAACGTGGCACTCCTCCTTCCTAAC       c.120
 S  L  G  T  A  A  L  F  A  A  G  A  N  V  A  L  L  L  P  N         p.40

          .         .         .         .         .         .       g.16010
 TGGGATGTCACCTACCTGTTGAGGGGCCTCCTTGGCAGGCATGCCATGCTGGGAACTGGG       c.180
 W  D  V  T  Y  L  L  R  G  L  L  G  R  H  A  M  L  G  T  G         p.60

          .         .  | 03      .         .         .         .    g.16427
 CTCTGGGGAGGAGGCCTCATG | GTACTCACTGCAGCTATCCTCATCTCCTTGATGGGCTGG    c.240
 L  W  G  G  G  L  M   | V  L  T  A  A  I  L  I  S  L  M  G  W      p.80

          .         .         .          | 04        .         .    g.19001
 AGATACGGCTGCTTCAGTAAGAGTGGGCTCTGTCGAAGC | GTGCTTACTGCTCTGTTGTCA    c.300
 R  Y  G  C  F  S  K  S  G  L  C  R  S   | V  L  T  A  L  L  S      p.100

          .         .         .         .         .         .       g.19061
 GGTGGCCTGGCTTTACTTGGAGCCCTGATTTGCTTTGTCACTTCTGGAGTTGCTCTGAAA       c.360
 G  G  L  A  L  L  G  A  L  I  C  F  V  T  S  G  V  A  L  K         p.120

          .         .         .         .         .         .       g.19121
 GATGGTCCTTTTTGCATGTTTGATGTTTCATCCTTCAATCAGACACAAGCTTGGAAATAT       c.420
 D  G  P  F  C  M  F  D  V  S  S  F  N  Q  T  Q  A  W  K  Y         p.140

          .         .          | 05        .         .         .    g.19454
 GGTTACCCATTCAAAGACCTGCATAGTAG | GAATTATCTGTATGACCGTTCGCTCTGGAAC    c.480
 G  Y  P  F  K  D  L  H  S  R  |  N  Y  L  Y  D  R  S  L  W  N      p.160

          .         .         .         .         .         .       g.19514
 TCCGTCTGCCTGGAGCCCTCTGCAGCTGTTGTCTGGCACGTGTCCCTCTTCTCCGCCCTT       c.540
 S  V  C  L  E  P  S  A  A  V  V  W  H  V  S  L  F  S  A  L         p.180

          .         .         .         .         .         .       g.19574
 CTGTGCATCAGCCTGCTCCAGCTTCTCCTGGTGGTCGTTCATGTCATCAACAGCCTCCTG       c.600
 L  C  I  S  L  L  Q  L  L  L  V  V  V  H  V  I  N  S  L  L         p.200

          .         .         .                                     g.19604
 GGCCTTTTCTGCAGCCTCTGCGAGAAGTGA                                     c.630
 G  L  F  C  S  L  C  E  K  X                                       p.209

          .         .         .         .         .         .       g.19664
 caggcagaaccttcacttgcaagcatgggtgttttcatcatcggctgtcttgaatccttt       c.*60

          .         .         .         .         .         .       g.19724
 ctacaaggagtgggtacgaattataaacaaacttcccctttaggtatccctggagtaata       c.*120

          .         .         .         .         .         .       g.19784
 atgacaacaaaattcactgcaggtcggtggaatgatagaatgcattttaaatcacattgt       c.*180

          .         .         .         .         .         .       g.19844
 aaacttccaggtgatccatggataggataaataactaagttattataattgtttaggaat       c.*240

          .         .         .                                     g.19875
 ttatagtccataaaatatcctccagccaggg                                    c.*271

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Transmembrane 4 L six family member 19 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.