transmembrane protein 126A (TMEM126A) - coding DNA reference sequence

(used for variant description)

(last modified November 26, 2020)


This file was created to facilitate the description of sequence variants on transcript NM_032273.3 in the TMEM126A gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_017157.2, covering TMEM126A transcript NM_032273.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
           .         .         .         .         .                g.5058
   aacctccgtcccgcagtccaattagcagccgcgacccggcgcccgcccacgccgcgtc       c.-121

 .         .         .         .         .         .                g.5118
 acgagtcagccaaagatggctgcgcccaggtaatttgagcaaaggccacagtgaactccg       c.-61

 .         .         .         .         .         .   | 02         g.7337
 gcgtggctgaggaaggaggaggcacccacaggctgctgggaggagagcataag | gctcaaa    c.-1

          .         .         .         .         .         .       g.7397
 ATGGAAAATCATAAATCCAATAATAAGGAAAACATAACAATTGTTGATATATCCAGAAAA       c.60
 M  E  N  H  K  S  N  N  K  E  N  I  T  I  V  D  I  S  R  K         p.20

          .         .       | 03 .         .         .         .    g.11178
 ATTAACCAGCTTCCAGAAGCAGAAAG | GAATCTACTTGAAAATGGATCGGTTTATGTTGGA    c.120
 I  N  Q  L  P  E  A  E  R  |  N  L  L  E  N  G  S  V  Y  V  G      p.40

          .         .         .         .         .         .       g.11238
 TTAAATGCTGCTCTTTGTGGCCTCATAGCAAACAGTCTTTTTCGACGCATCTTGAATGTG       c.180
 L  N  A  A  L  C  G  L  I  A  N  S  L  F  R  R  I  L  N  V         p.60

          .         .         .         .         .         .       g.11298
 ACAAAGGCTCGCATAGCTGCTGGCTTACCAATGGCAGGGATACCTTTTCTTACAACAGAC       c.240
 T  K  A  R  I  A  A  G  L  P  M  A  G  I  P  F  L  T  T  D         p.80

          .         .         .         . | 04       .         .    g.12695
 TTAACTTACAGATGTTTTGTAAGTTTTCCTTTGAATACAG | GTGATTTGGATTGTGAAACC    c.300
 L  T  Y  R  C  F  V  S  F  P  L  N  T  G |   D  L  D  C  E  T      p.100

          .         .         .         .         .         .       g.12755
 TGTACCATAACACGGAGTGGACTGACTGGTCTTGTTATTGGTGGTCTATACCCTGTTTTC       c.360
 C  T  I  T  R  S  G  L  T  G  L  V  I  G  G  L  Y  P  V  F         p.120

          .         .         .      | 05  .         .         .    g.13415
 TTGGCTATACCTGTAAATGGTGGTCTAGCAGCCAG | GTATCAATCAGCTCTGTTACCACAC    c.420
 L  A  I  P  V  N  G  G  L  A  A  R  |  Y  Q  S  A  L  L  P  H      p.140

          .         .         .         .         .         .       g.13475
 AAAGGGAACATCTTAAGTTACTGGATTAGAACTTCTAAGCCTGTCTTTAGAAAGATGTTA       c.480
 K  G  N  I  L  S  Y  W  I  R  T  S  K  P  V  F  R  K  M  L         p.160

          .         .         .         .         .         .       g.13535
 TTTCCTATTTTGCTCCAGACTATGTTTTCAGCATACCTTGGGTCTGAACAATATAAACTA       c.540
 F  P  I  L  L  Q  T  M  F  S  A  Y  L  G  S  E  Q  Y  K  L         p.180

          .         .         .         .                           g.13583
 CTTATAAAGGCCCTTCAGTTATCTGAACCTGGCAAAGAAATTCACTGA                   c.588
 L  I  K  A  L  Q  L  S  E  P  G  K  E  I  H  X                     p.195

          .         .         .         .         .                 g.13635
 ttttaaacaaatatgtaaacaaaaataaaatggtaaaaacagtttatgtcta               c.*52

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Transmembrane protein 126A protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 25b
©2004-2020 Leiden University Medical Center