transmembrane protein 216 (TMEM216) - coding DNA reference sequence

(used for variant description)

(last modified September 10, 2024)

This file was created to facilitate the description of sequence variants on transcript NM_001173990.2 in the TMEM216 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000011.9, covering TMEM216 transcript NM_001173990.2.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                               .         .         .                g.5032
                             acttccgcccaacgcccggtagtctgagagcc       c.-241

 .         .         .         .         .         .                g.5092
 tccaaggtcctcccccgcacccctgaggtcctgcagacgacggcgtcgtgggtggtcacc       c.-181

 .         .         .         .         .         .                g.5152
 gttatcccttaggtctggagaggggacatccgagcgagggccacttgcggccaggcccga       c.-121

 .         .         .         .         .         .                g.5212
 gctcgtccagctccgggtgaccacagagtgccgcgggcgggcagaggggccggaaaccca       c.-61

 .         .         .         .         .         .                g.5272
 ggccgcttcgtccctgtttccggcagcgccgcgctgctccgggagccgctgtggcagcgt       c.-1

          .         .         .     | 02   .         .         .    g.5897
 ATGCTGCCACGGGGACTGAAGATGGCGCCGCGAG | GTAAACGGTTGTCCTCCACCCCGCTG    c.60
 M  L  P  R  G  L  K  M  A  P  R  G |   K  R  L  S  S  T  P  L      p.20

          .         .         .         .         .         .       g.5957
 GAAATCCTGTTCTTTCTGAACGGGTGGTATAATGCTACCTATTTCCTGCTGGAACTTTTC       c.120
 E  I  L  F  F  L  N  G  W  Y  N  A  T  Y  F  L  L  E  L  F         p.40

          .       | 03 .         .         .         .         .    g.6568
 ATATTTCTGTATAAAG | GTGTCCTGCTACCATATCCAACAGCTAACCTAGTACTGGATGTG    c.180
 I  F  L  Y  K  G |   V  L  L  P  Y  P  T  A  N  L  V  L  D  V      p.60

          .         .         .         .          | 04        .    g.10425
 GTGATGCTCCTCCTTTATCTTGGAATTGAAGTAATTCGCCTGTTTTTTG | GTACAAAGGGA    c.240
 V  M  L  L  L  Y  L  G  I  E  V  I  R  L  F  F  G |   T  K  G      p.80

          .         .         .         .         .         .       g.10485
 AACCTCTGCCAGCGAAAGATGCCGCTCAGTATTAGCGTGGCCTTGACCTTCCCATCTGCC       c.300
 N  L  C  Q  R  K  M  P  L  S  I  S  V  A  L  T  F  P  S  A         p.100

          .         .         .         .         .         .       g.10545
 ATGATGGCCTCCTATTACCTGCTGCTGCAGACCTACGTACTCCGCCTGGAAGCCATCATG       c.360
 M  M  A  S  Y  Y  L  L  L  Q  T  Y  V  L  R  L  E  A  I  M         p.120

          .         .         .         .         .         .       g.10605
 AATGGCATCTTGCTCTTCTTCTGTGGCTCAGAGCTTTTACTTGAGGTGCTCACCTTGGCT       c.420
 N  G  I  L  L  F  F  C  G  S  E  L  L  L  E  V  L  T  L  A         p.140

          .  | 05                                                   g.10959
 GCTTTCTCCAG | GATTTGA                                              c.438
 A  F  S  R  |  I  X                                                p.145

          .         .         .         .         .         .       g.11019
 agtacagaatttcagccagcagcccatcaggctgacaccacacatattgcttctggtact       c.*60

          .         .         .         .         .         .       g.11079
 ttagccacaccagtgagaattggtggggcaagttgtcctgagaaaggctgtgtggctttt       c.*120

          .         .         .         .         .         .       g.11139
 cttcagcacagacatttgggcaagcaactcagcataaggccagtgggtaccatcttctaa       c.*180

          .         .         .         .         .         .       g.11199
 accaggaccatcagcccaagagactcttctacactccagtatagggaggggcaaggttat       c.*240

          .         .         .         .         .         .       g.11259
 tcccatcctgccccttctcagaaccagtcccctgctgacctcaagttctcctccttgatc       c.*300

          .         .         .         .         .         .       g.11319
 accgtggccagagcatctcgtgtggaccatctaggctccttgggcttcaagcaggacctg       c.*360

          .         .         .         .         .         .       g.11379
 agccacatgctccctgtacgagctgtgctatacctgtcccacatgagcacggagagcctc       c.*420

          .         .         .         .         .         .       g.11439
 atgttggtgggtttccagagtgatgtgaaagcctctcaccccaatcctcggagactgagt       c.*480

          .         .         .         .         .         .       g.11499
 tccacaacttttttagtagctcatagtgttatttttctactctcttcatgaaactaactt       c.*540

          .         .         .         .                           g.11546
 tattttataataaatatgtattttctgttgtgggggttgcagccttt                    c.*587

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Transmembrane protein 216 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.