transmembrane protein 240 (TMEM240) - coding DNA reference sequence

(used for variant description)

(last modified February 16, 2018)

This file was created to facilitate the description of sequence variants on transcript NM_001114748.1 in the TMEM240 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_041807.1, covering TMEM240 transcript NM_001114748.1.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                                   .                g.5014
                                               cccggccccgcccg       c.-1

          .         .         .         .         .        | 02.    g.5573
 ATGTCCATGAGCGCGAACACCATGATCTTCATGATTCTGGGGGCGTCGGTCGTGATG | GCC    c.60
 M  S  M  S  A  N  T  M  I  F  M  I  L  G  A  S  V  V  M   | A      p.20

          .         .         .         .         .         .       g.5633
 ATCGCGTGCTTGATGGACATGAACGCGCTGCTGGACCGATTCCACAACTACATCCTCCCG       c.120
 I  A  C  L  M  D  M  N  A  L  L  D  R  F  H  N  Y  I  L  P         p.40

          .         .         .         .     | 03   .         .    g.9579
 CACCTGCGGGGCGAGGACCGCGTCTGCCACTGCAACTGTGGCCG | GCACCATATCCACTAC    c.180
 H  L  R  G  E  D  R  V  C  H  C  N  C  G  R  |  H  H  I  H  Y      p.60

          .         .         .         .         .         .       g.9639
 GTGATCCCGTACGACGGGGACCAGTCGGTGGTGGACGCCTCCGAGAACTACTTTGTGACG       c.240
 V  I  P  Y  D  G  D  Q  S  V  V  D  A  S  E  N  Y  F  V  T         p.80

          .         .         .         .         .         .       g.9699
 GACAGTGTGACCAAGCAGGAGATCGACCTCATGCTGGGGCTGCTGCTGGGCTTTTGCATC       c.300
 D  S  V  T  K  Q  E  I  D  L  M  L  G  L  L  L  G  F  C  I         p.100

          .         .         .         .         .         .       g.9759
 AGCTGGTTCCTGGTGTGGATGGACGGCGTCCTGCACTGCGCCGTGCGCGCCTGGAGAGCC       c.360
 S  W  F  L  V  W  M  D  G  V  L  H  C  A  V  R  A  W  R  A         p.120

          .    | 04    .         .         .         .         .    g.9900
 GGACGGCGCTACG | ATGGCTCGTGGACCTGGCTGCCCAAGCTGTGCAGCCTGCGGGAGCTG    c.420
 G  R  R  Y  D |   G  S  W  T  W  L  P  K  L  C  S  L  R  E  L      p.140

          .         .         .         .         .         .       g.9960
 GGCCGGCGGCCGCACAGGCCCTTCGAGGAGGCCGCCGGGAACATGGTACACGTGAAGCAG       c.480
 G  R  R  P  H  R  P  F  E  E  A  A  G  N  M  V  H  V  K  Q         p.160

          .         .         .         .                           g.10002
 AAACTCTACCACAATGGCCACCCCAGCCCGCGGCACCTGTGA                         c.522
 K  L  Y  H  N  G  H  P  S  P  R  H  L  X                           p.173

          .         .         .         .         .         .       g.10062
 gccgcacggggacttaccggggccaccgagccaaccggctgctgtacagatgtaaaaggg       c.*60

          .         .         .         .         .         .       g.10122
 acctcgtggacgcccgggccggcgggactggacagcagccctgggcccaggttgtccggg       c.*120

          .         .         .         .         .         .       g.10182
 gctgtggccggccgggagagtccagtggaaggtgctgtctcttctttttataaagggggt       c.*180

          .         .         .         .         .         .       g.10242
 tggggtgtgggctagggtgggggttgggttaggggagaccctgcagttggggggcaggac       c.*240

          .         .         .         .         .         .       g.10302
 acaagggcggactcatccccagcggtgctggggggcagggagggtcctggggggcaggga       c.*300

          .         .         .         .         .         .       g.10362
 gggtcctggggggcaggtgggggcaggggcggcgaggcgcgcggcccgggccagcatctg       c.*360

          .         .         .         .         .         .       g.10422
 tttgaaggcgctgtttcccgtgcgctgcgtccaccgtctgtctggccccagccagcttgg       c.*420

          .         .         .         .         .         .       g.10482
 gcggaggggaggggggcgaggggagcacccgcgtgtgcacagccacagggtggggtgcag       c.*480

          .         .         .         .         .         .       g.10542
 gtggctgggcccaggcagcattcaggcccctggccccgcagtggcgggcactcatgtgaa       c.*540

          .         .         .         .                           g.10583
 gcccacccctctgtggtcagtaaattctccagaaagcgcca                          c.*581

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Transmembrane protein 240 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.