transmembrane protein 70 (TMEM70) - coding DNA reference sequence

(used for variant description)

(last modified February 2, 2014)

This file was created to facilitate the description of sequence variants on transcript NM_017866.5 in the TMEM70 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000008.10, covering TMEM70 transcript NM_017866.5.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
                                         .         .                g.5020
                                         gcacgcgcaggcagcccagc       c.-121

 .         .         .         .         .         .                g.5080
 tgccagtcaggcgtcccgggctgggcatgcgccacttgtgcggcagtcgggtgggaagcc       c.-61

 .         .         .         .         .         .                g.5140
 gtgtctcgcagtcgtggactcgtgcagctggggcgtccgcagccgctcgtcacccgcgtg       c.-1

          .         .         .         .         .         .       g.5200
 ATGCTGTTTCTGGCGTTGGGCAGCCCGTGGGCGGTCGAACTGCCTCTCTGCGGAAGGAGG       c.60
 M  L  F  L  A  L  G  S  P  W  A  V  E  L  P  L  C  G  R  R         p.20

          .         .         .         .         .         .       g.5260
 ACTGCATTGTGTGCGGCCGCCGCGCTCCGAGGTCCCCGGGCCTCTGTCTCCCGGGCGTCC       c.120
 T  A  L  C  A  A  A  A  L  R  G  P  R  A  S  V  S  R  A  S         p.40

          .         .         .         .         .         .       g.5320
 TCCAGCAGCGGGCCTTCGGGGCCGGTAGCCGGCTGGAGTACGGGGCCTTCGGGAGCCGCG       c.180
 S  S  S  G  P  S  G  P  V  A  G  W  S  T  G  P  S  G  A  A         p.60

          .         .         . | 02       .         .         .    g.7644
 CGCCTTCTCCGGCGTCCGGGTCGAGCGCAG | ATCCCTGTTTATTGGGAAGGATATGTTCGA    c.240
 R  L  L  R  R  P  G  R  A  Q   | I  P  V  Y  W  E  G  Y  V  R      p.80

          .         .         .         .         .         .       g.7704
 TTCTTAAATACGCCATCTGACAAATCAGAAGATGGAAGGCTAATTTATACTGGCAATATG       c.300
 F  L  N  T  P  S  D  K  S  E  D  G  R  L  I  Y  T  G  N  M         p.100

          .       | 03 .         .         .         .         .    g.10057
 GCCCGAGCAGTGTTTG | GTGTGAAATGTTTCTCTTATTCTACGAGTCTGATTGGCCTTACA    c.360
 A  R  A  V  F  G |   V  K  C  F  S  Y  S  T  S  L  I  G  L  T      p.120

          .         .         .         .         .         .       g.10117
 TTTCTGCCATACATTTTTACACAAAATAATGCTATTTCTGAAAGTGTGCCTCTGCCTATT       c.420
 F  L  P  Y  I  F  T  Q  N  N  A  I  S  E  S  V  P  L  P  I         p.140

          .         .         .         .         .         .       g.10177
 CAAATCATATTCTATGGCATCATGGGAAGCTTTACGGTGATCACCCCAGTGCTGCTTCAC       c.480
 Q  I  I  F  Y  G  I  M  G  S  F  T  V  I  T  P  V  L  L  H         p.160

          .         .         .         .         .         .       g.10237
 TTTATTACAAAAGGCTATGTCATTCGATTGTACCATGAGGCCACAACAGACACTTATAAA       c.540
 F  I  T  K  G  Y  V  I  R  L  Y  H  E  A  T  T  D  T  Y  K         p.180

          .         .         .         .         .         .       g.10297
 GCCATTACCTACAATGCTATGCTTGCAGAAACGAGTACAGTGTTTCACCAGAATGATGTG       c.600
 A  I  T  Y  N  A  M  L  A  E  T  S  T  V  F  H  Q  N  D  V         p.200

          .         .         .         .         .         .       g.10357
 AAGATTCCAGATGCTAAACATGTATTTACCACATTTTATGCTAAAACAAAATCACTGTTA       c.660
 K  I  P  D  A  K  H  V  F  T  T  F  Y  A  K  T  K  S  L  L         p.220

          .         .         .         .         .         .       g.10417
 GTTAATCCAGTGCTCTTTCCAAACCGTGAAGACTATATCCATCTAATGGGTTATGACAAA       c.720
 V  N  P  V  L  F  P  N  R  E  D  Y  I  H  L  M  G  Y  D  K         p.240

          .         .         .         .         .         .       g.10477
 GAAGAATTTATTTTGTATATGGAAGAAACCAGTGAAGAGAAACGGCATAAAGATGACAAA       c.780
 E  E  F  I  L  Y  M  E  E  T  S  E  E  K  R  H  K  D  D  K         p.260

                                                                    g.10480
 TGA                                                                c.783
 X                                                                  p.260

          .         .         .         .         .         .       g.10540
 gcctatttgttagtgttcgtgctcaaatgtgatttacgttttaatgtataataataaaat       c.*60

          .         .         .         .         .         .       g.10600
 tgccttttgcattccgttagtgactgattgttaaaaataatttgaaattatcaaagcttt       c.*120

          .         .         .         .         .         .       g.10660
 taatttccagagaatgatgtttgtttataataaaacaagctatgtttgaaaaccaaaatg       c.*180

          .         .         .         .         .         .       g.10720
 tagtatctaccattcgtgttttagaaaggtatgtgaataaatatgttcatgctagtataa       c.*240

          .         .         .         .         .         .       g.10780
 gagttctgtgttactgtggttgactctaaactggggatctgatgtcagtagcaaatggga       c.*300

          .         .         .         .         .         .       g.10840
 gagttgctttattctttgtgtatggatttttctaagtgtataaatattttccgacattaa       c.*360

          .         .         .         .         .         .       g.10900
 aagacattttctctttgaggaagacacagtcataggtggtgcggagctgtggtccacctg       c.*420

          .         .         .         .         .         .       g.10960
 ctcctgctcctgactcactgctctttgctgttgcctgaggaccaagtctgtcaggaagct       c.*480

          .         .         .         .         .         .       g.11020
 ggctaggaagccttgcagcagccatggcttttaaacataccagaaaaacacccgtggagt       c.*540

          .         .         .         .         .         .       g.11080
 cagaggtggcaattcaccgaattcatatcactctaacgagttgcaacgtaaaatccctgg       c.*600

          .         .         .         .         .         .       g.11140
 ataaggtgtgtgctgacttgatctgaggagcaaaggaaaagaatcagtgaaaggaccagt       c.*660

          .         .         .         .         .         .       g.11200
 ttgaatgcctaccaagactttgagaatcactacaagaaaaacttacggtgaaggttctaa       c.*720

          .         .         .         .         .         .       g.11260
 ggcatgggatcgtttccagatgagaatccacaagcgactcattgacttgcgcagtcctca       c.*780

          .         .         .         .         .         .       g.11320
 gatagttaagcagattacttccatcagtattgagccaggagttgagatggaagtcaccat       c.*840

          .         .         .         .         .         .       g.11380
 tgcaaatgcttaagtcaactgttttcataaattgattaccagttgttaaaaaattttcaa       c.*900

          .         .         .         .         .         .       g.11440
 aaaaccgcaaaatttcaagaaattcacaaattatgggagcagttttaagtcttctttggt       c.*960

          .         .         .         .         .         .       g.11500
 tcagaacacaggtttttgcctaacccctggcatgattgcccataagaacatacatgtaca       c.*1020

          .         .         .         .         .         .       g.11560
 gttgaactggtggttagctatacgggaaatggtaagtagtgttgtcttcagtatcttaat       c.*1080

          .         .         .         .         .         .       g.11620
 ttgtttctgcaactgtgcactcctcccttggtggcaccctatgggtgtaggaaaaccact       c.*1140

          .         .                                               g.11642
 gttattaaacaggtgaaaaata                                             c.*1162

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Transmembrane protein 70 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.