tumor necrosis factor, alpha-induced protein 3 (TNFAIP3) - coding DNA reference sequence

(used for variant description)

(last modified July 6, 2017)


This file was created to facilitate the description of sequence variants on transcript NM_006290.3 in the TNFAIP3 gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NG_032761.1, covering TNFAIP3 transcript NM_006290.3.


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                         .         .                g.4766
                                       ctttggaaagtcccgtggaaat       c.-301

 .         .         .         .         .         .                g.4826
 ccccgggcctacaacccgcatacaactgaaacggggcaaagcagactgcgcagtctgcag       c.-241

 .         .         .         .         .         .                g.4886
 tcttcgtggcgggccaagcgagcttggagcccgcgggggcggagcggtgagagcggccgc       c.-181

 .         .         .         .         .         .                g.4946
 caagagagatcacacccccagccgaccctgccagcgagcgagcccgaccccaggcgtcca       c.-121

 .         .         .         .         .         .                g.5006
 tggagcgtcgcctccgcccggtccctgccccgacccccgcctgcggcgcgctcctgcctt       c.-61

 .         .         .         .         .     | 02   .             g.8784
 gaccaggacttgggactttgcgaaaggatcgcggggcccggagag | gtgttggagagcaca    c.-1

          .         .         .         .         .         .       g.8844
 ATGGCTGAACAAGTCCTTCCTCAGGCTTTGTATTTGAGCAATATGCGGAAAGCTGTGAAG       c.60
 M  A  E  Q  V  L  P  Q  A  L  Y  L  S  N  M  R  K  A  V  K         p.20

          .         .         .         .         .         .       g.8904
 ATACGGGAGAGAACTCCAGAAGACATTTTTAAACCTACTAATGGGATCATTCATCATTTT       c.120
 I  R  E  R  T  P  E  D  I  F  K  P  T  N  G  I  I  H  H  F         p.40

          .         .         .         .         .         .       g.8964
 AAAACCATGCACCGATACACACTGGAAATGTTCAGAACTTGCCAGTTTTGTCCTCAGTTT       c.180
 K  T  M  H  R  Y  T  L  E  M  F  R  T  C  Q  F  C  P  Q  F         p.60

          .         .         .         .         .         .       g.9024
 CGGGAGATCATCCACAAAGCCCTCATCGACAGAAACATCCAGGCCACCCTGGAAAGCCAG       c.240
 R  E  I  I  H  K  A  L  I  D  R  N  I  Q  A  T  L  E  S  Q         p.80

          .         .         .         .         .      | 03  .    g.12406
 AAGAAACTCAACTGGTGTCGAGAAGTCCGGAAGCTTGTGGCGCTGAAAACGAACG | GTGAC    c.300
 K  K  L  N  W  C  R  E  V  R  K  L  V  A  L  K  T  N  G |   D      p.100

          .         .         .         .         .         .       g.12466
 GGCAATTGCCTCATGCATGCCACTTCTCAGTACATGTGGGGCGTTCAGGACACAGACTTG       c.360
 G  N  C  L  M  H  A  T  S  Q  Y  M  W  G  V  Q  D  T  D  L         p.120

          .         .         .         .         .         .       g.12526
 GTACTGAGGAAGGCGCTGTTCAGCACGCTCAAGGAAACAGACACACGCAACTTTAAATTC       c.420
 V  L  R  K  A  L  F  S  T  L  K  E  T  D  T  R  N  F  K  F         p.140

          .         .         .         .         .         .       g.12586
 CGCTGGCAACTGGAGTCTCTCAAATCTCAGGAATTTGTTGAAACGGGGCTTTGCTATGAT       c.480
 R  W  Q  L  E  S  L  K  S  Q  E  F  V  E  T  G  L  C  Y  D         p.160

        | 04 .         .         .         .         .         .    g.13298
 ACTCGG | AACTGGAATGATGAATGGGACAATCTTATCAAAATGGCTTCCACAGACACACCC    c.540
 T  R   | N  W  N  D  E  W  D  N  L  I  K  M  A  S  T  D  T  P      p.180

          .         .         .         .         .         .       g.13358
 ATGGCCCGAAGTGGACTTCAGTACAACTCACTGGAAGAAATACACATATTTGTCCTTTGC       c.600
 M  A  R  S  G  L  Q  Y  N  S  L  E  E  I  H  I  F  V  L  C         p.200

          .         .         .     | 05   .         .         .    g.13578
 AACATCCTCAGAAGGCCAATCATTGTCATTTCAG | ACAAAATGCTAAGAAGTTTGGAATCA    c.660
 N  I  L  R  R  P  I  I  V  I  S  D |   K  M  L  R  S  L  E  S      p.220

          .         .         .         .         .         .       g.13638
 GGTTCCAATTTCGCCCCTTTGAAAGTGGGTGGAATTTACTTGCCTCTCCACTGGCCTGCC       c.720
 G  S  N  F  A  P  L  K  V  G  G  I  Y  L  P  L  H  W  P  A         p.240

          .         .         .         .         .         .       g.13698
 CAGGAATGCTACAGATACCCCATTGTTCTCGGCTATGACAGCCATCATTTTGTACCCTTG       c.780
 Q  E  C  Y  R  Y  P  I  V  L  G  Y  D  S  H  H  F  V  P  L         p.260

          .         .      | 06  .         .         .         .    g.14667
 GTGACCCTGAAGGACAGTGGGCCTG | AAATCCGAGCTGTTCCACTTGTTAACAGAGACCGG    c.840
 V  T  L  K  D  S  G  P  E |   I  R  A  V  P  L  V  N  R  D  R      p.280

          .         .         .         .         .         .       g.14727
 GGAAGATTTGAAGACTTAAAAGTTCACTTTTTGACAGATCCTGAAAATGAGATGAAGGAG       c.900
 G  R  F  E  D  L  K  V  H  F  L  T  D  P  E  N  E  M  K  E         p.300

          .         .         .         .         .         .       g.14787
 AAGCTCTTAAAAGAGTACTTAATGGTGATAGAAATCCCCGTCCAAGGCTGGGACCATGGC       c.960
 K  L  L  K  E  Y  L  M  V  I  E  I  P  V  Q  G  W  D  H  G         p.320

          .         .       | 07 .         .         .         .    g.16022
 ACAACTCATCTCATCAATGCCGCAAA | GTTGGATGAAGCTAACTTACCAAAAGAAATCAAT    c.1020
 T  T  H  L  I  N  A  A  K  |  L  D  E  A  N  L  P  K  E  I  N      p.340

          .         .         .         .         .         .       g.16082
 CTGGTAGATGATTACTTTGAACTTGTTCAGCATGAGTACAAGAAATGGCAGGAAAACAGC       c.1080
 L  V  D  D  Y  F  E  L  V  Q  H  E  Y  K  K  W  Q  E  N  S         p.360

          .         .         .         .         .         .       g.16142
 GAGCAGGGGAGGAGAGAGGGGCACGCCCAGAATCCCATGGAACCTTCCGTGCCCCAGCTT       c.1140
 E  Q  G  R  R  E  G  H  A  Q  N  P  M  E  P  S  V  P  Q  L         p.380

          .         .         .         .         .         .       g.16202
 TCTCTCATGGATGTAAAATGTGAAACGCCCAACTGCCCCTTCTTCATGTCTGTGAACACC       c.1200
 S  L  M  D  V  K  C  E  T  P  N  C  P  F  F  M  S  V  N  T         p.400

          .         .         .         .         .         .       g.16262
 CAGCCTTTATGCCATGAGTGCTCAGAGAGGCGGCAAAAGAATCAAAACAAACTCCCAAAG       c.1260
 Q  P  L  C  H  E  C  S  E  R  R  Q  K  N  Q  N  K  L  P  K         p.420

          .         .         .         .         .         .       g.16322
 CTGAACTCCAAGCCGGGCCCTGAGGGGCTCCCTGGCATGGCGCTCGGGGCCTCTCGGGGA       c.1320
 L  N  S  K  P  G  P  E  G  L  P  G  M  A  L  G  A  S  R  G         p.440

          .         .         .         .         .         .       g.16382
 GAAGCCTATGAGCCCTTGGCGTGGAACCCTGAGGAGTCCACTGGGGGGCCTCATTCGGCC       c.1380
 E  A  Y  E  P  L  A  W  N  P  E  E  S  T  G  G  P  H  S  A         p.460

          .         .         .         .         .         .       g.16442
 CCACCGACAGCACCCAGCCCTTTTCTGTTCAGTGAGACCACTGCCATGAAGTGCAGGAGC       c.1440
 P  P  T  A  P  S  P  F  L  F  S  E  T  T  A  M  K  C  R  S         p.480

          .         .         .         .         .         .       g.16502
 CCCGGCTGCCCCTTCACACTGAATGTGCAGCACAACGGATTTTGTGAACGTTGCCACAAC       c.1500
 P  G  C  P  F  T  L  N  V  Q  H  N  G  F  C  E  R  C  H  N         p.500

          .         .         .         .         .         .       g.16562
 GCCCGGCAACTTCACGCCAGCCACGCCCCAGACCACACAAGGCACTTGGATCCCGGGAAG       c.1560
 A  R  Q  L  H  A  S  H  A  P  D  H  T  R  H  L  D  P  G  K         p.520

          .         .         .         .         .         .       g.16622
 TGCCAAGCCTGCCTCCAGGATGTTACCAGGACATTTAATGGGATCTGCAGTACTTGCTTC       c.1620
 C  Q  A  C  L  Q  D  V  T  R  T  F  N  G  I  C  S  T  C  F         p.540

          .         .         .         .         .         .       g.16682
 AAAAGGACTACAGCAGAGGCCTCCTCCAGCCTCAGCACCAGCCTCCCTCCTTCCTGTCAC       c.1680
 K  R  T  T  A  E  A  S  S  S  L  S  T  S  L  P  P  S  C  H         p.560

          .         .         .         .         .         .       g.16742
 CAGCGTTCCAAGTCAGATCCCTCGCGGCTCGTCCGGAGCCCCTCCCCGCATTCTTGCCAC       c.1740
 Q  R  S  K  S  D  P  S  R  L  V  R  S  P  S  P  H  S  C  H         p.580

          .         .         .         .         .         .       g.16802
 AGAGCTGGAAACGACGCCCCTGCTGGCTGCCTGTCTCAAGCTGCACGGACTCCTGGGGAC       c.1800
 R  A  G  N  D  A  P  A  G  C  L  S  Q  A  A  R  T  P  G  D         p.600

          .         .         .         .         .         .       g.16862
 AGGACGGGGACGAGCAAGTGCAGAAAAGCCGGCTGCGTGTATTTTGGGACTCCAGAAAAC       c.1860
 R  T  G  T  S  K  C  R  K  A  G  C  V  Y  F  G  T  P  E  N         p.620

          .         .         .         .       | 08 .         .    g.17641
 AAGGGCTTTTGCACACTGTGTTTCATCGAGTACAGAGAAAACAAAC | ATTTTGCTGCTGCC    c.1920
 K  G  F  C  T  L  C  F  I  E  Y  R  E  N  K  H |   F  A  A  A      p.640

          .         .         .         .         .         .       g.17701
 TCAGGGAAAGTCAGTCCCACAGCGTCCAGGTTCCAGAACACCATTCCGTGCCTGGGGAGG       c.1980
 S  G  K  V  S  P  T  A  S  R  F  Q  N  T  I  P  C  L  G  R         p.660

          .         .         .         .         .         .       g.17761
 GAATGCGGCACCCTTGGAAGCACCATGTTTGAAGGATACTGCCAGAAGTGTTTCATTGAA       c.2040
 E  C  G  T  L  G  S  T  M  F  E  G  Y  C  Q  K  C  F  I  E         p.680

          .         .         .         .         | 09         .    g.18603
 GCTCAGAATCAGAGATTTCATGAGGCCAAAAGGACAGAAGAGCAACTG | AGATCGAGCCAG    c.2100
 A  Q  N  Q  R  F  H  E  A  K  R  T  E  E  Q  L   | R  S  S  Q      p.700

          .         .         .         .         .         .       g.18663
 CGCAGAGATGTGCCTCGAACCACACAAAGCACCTCAAGGCCCAAGTGCGCCCGGGCCTCC       c.2160
 R  R  D  V  P  R  T  T  Q  S  T  S  R  P  K  C  A  R  A  S         p.720

          .         .         .         .         .         .       g.18723
 TGCAAGAACATCCTGGCCTGCCGCAGCGAGGAGCTCTGCATGGAGTGTCAGCATCCCAAC       c.2220
 C  K  N  I  L  A  C  R  S  E  E  L  C  M  E  C  Q  H  P  N         p.740

          .         .         .         .         .         .       g.18783
 CAGAGGATGGGCCCTGGGGCCCACCGGGGTGAGCCTGCCCCCGAAGACCCCCCCAAGCAG       c.2280
 Q  R  M  G  P  G  A  H  R  G  E  P  A  P  E  D  P  P  K  Q         p.760

          .         .         .         .         .         .       g.18843
 CGTTGCCGGGCCCCCGCCTGTGATCATTTTGGCAATGCCAAGTGCAACGGCTACTGCAAC       c.2340
 R  C  R  A  P  A  C  D  H  F  G  N  A  K  C  N  G  Y  C  N         p.780

          .         .         .                                     g.18876
 GAATGCTTTCAGTTCAAGCAGATGTATGGCTAA                                  c.2373
 E  C  F  Q  F  K  Q  M  Y  G  X                                    p.790

          .         .         .         .         .         .       g.18936
 ccggaaacaggtgggtcacctcctgcaagaagtggggcctcgagctgtcagtcatcatgg       c.*60

          .         .         .         .         .         .       g.18996
 tgctatcctctgaacccctcagctgccactgcaacagtgggcttaagggtgtctgagcag       c.*120

          .         .         .         .         .         .       g.19056
 gagaggaaagataagctcttcgtggtgcccacgatgctcaggtttggtaacccgggagtg       c.*180

          .         .         .         .         .         .       g.19116
 ttcccaggtggccttagaaagcaaagcttgtaactggcaagggatgatgtcagattcagc       c.*240

          .         .         .         .         .         .       g.19176
 ccaaggttcctcctctcctaccaagcaggaggccaggaacttctttggacttggaaggtg       c.*300

          .         .         .         .         .         .       g.19236
 tgcggggactggccgaggcccctgcaccctgcgcatcaggactgcttcatcgtcttggct       c.*360

          .         .         .         .         .         .       g.19296
 gagaaagggaaaagacacacaagtcgcgtgggttggagaagccagagccattccacctcc       c.*420

          .         .         .         .         .         .       g.19356
 cctcccccagcatctctcagagatgtgaagccagatcctcatggcagcgaggccctctgc       c.*480

          .         .         .         .         .         .       g.19416
 aagaagctcaaggaagctcagggaaaatggacgtattcagagagtgtttgtagttcatgg       c.*540

          .         .         .         .         .         .       g.19476
 tttttccctacctgcccggttcctttcctgaggacccggcagaaatgcagaaccatccat       c.*600

          .         .         .         .         .         .       g.19536
 ggactgtgattctgaggctgctgagactgaacatgttcacattgacagaaaaacaagctg       c.*660

          .         .         .         .         .         .       g.19596
 ctctttataatatgcaccttttaaaaaattagaatattttactgggaagacgtgtaactc       c.*720

          .         .         .         .         .         .       g.19656
 tttgggttattactgtctttacttctaaagaagttagcttgaactgaggagtaaaagtgt       c.*780

          .         .         .         .         .         .       g.19716
 gtacatatataatatacccttacattatgtatgagggatttttttaaattatattgaaat       c.*840

          .         .         .         .         .         .       g.19776
 gctgccctagaagtacaataggaaggctaaataataataacctgttttctggttgttgtt       c.*900

          .         .         .         .         .         .       g.19836
 ggggcatgagcttgtgtatacactgcttgcataaactcaaccagctgcctttttaaaggg       c.*960

          .         .         .         .         .         .       g.19896
 agctctagtcctttttgtgtaattcactttatttattttattacaaacttcaagattatt       c.*1020

          .         .         .         .         .         .       g.19956
 taagtgaagatatttcttcagctctggggaaaatgccacagtgttctcctgagagaacat       c.*1080

          .         .         .         .         .         .       g.20016
 ccttgctttgagtcaggctgtgggcaagttcctgaccacagggagtaaattggcctcttt       c.*1140

          .         .         .         .         .         .       g.20076
 gatacacttttgcttgcctccccaggaaagaaggaattgcatccaaggtatacatacata       c.*1200

          .         .         .         .         .         .       g.20136
 ttcatcgatgtttcgtgcttctccttatgaaactccagctatgtaataaaaaactatact       c.*1260

          .         .         .         .         .         .       g.20196
 ctgtgttctgttaatgcctctgagtgtcctacctccttggagatgagatagggaaggagc       c.*1320

          .         .         .         .         .         .       g.20256
 agggatgagactggcaatggtcacagggaaagatgtggccttttgtgatggttttatttt       c.*1380

          .         .         .         .         .         .       g.20316
 ctgttaacactgtgtcctgggggggctgggaagtcccctgcatcccatggtaccctggta       c.*1440

          .         .         .         .         .         .       g.20376
 ttgggacagcaaaagccagtaaccatgagtatgaggaaatctctttctgttgctggctta       c.*1500

          .         .         .         .         .         .       g.20436
 cagtttctctgtgtgctttgtggttgctgtcatatttgctctagaagaaaaaaaaaaaag       c.*1560

          .         .         .         .         .         .       g.20496
 gaggggaaatgcattttccccagagataaaggctgccattttgggggtctgtacttatgg       c.*1620

          .         .         .         .         .         .       g.20556
 cctgaaaatatttgtgatccataactctacacagcctttactcatactattaggcacact       c.*1680

          .         .         .         .         .         .       g.20616
 ttccccttagagccccctaagtttttcccagacgaatctttataatttctttccaaagat       c.*1740

          .         .         .         .         .         .       g.20676
 accaaataaacttcagtgttttcatctaattctcttaaagttgatatcttaatattttgt       c.*1800

          .         .         .         .         .         .       g.20736
 gttgatcattatttccattcttaatgtgaaaaaaagtaattatttatacttattataaaa       c.*1860

          .         .         .         .         .         .       g.20796
 agtatttgaaatttgcacatttaattgtccctaatagaaagccacctattctttgttgga       c.*1920

          .         .         .         .         .         .       g.20856
 tttcttcaagtttttctaaataaatgtaacttttcacaagagtcaacattaaaaaataaa       c.*1980

          .                                                         g.20871
 ttatttaagaacaga                                                    c.*1995

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Tumor necrosis factor, alpha-induced protein 3 protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVD v.3.0 Build 19
©2004-2017 Leiden University Medical Center