tumor necrosis factor (TNF) - coding DNA reference sequence

(used for variant description)

(last modified October 27, 2021)

This file was created to facilitate the description of sequence variants on transcript NM_000594.3 in the TNF gene based on a coding DNA reference sequence following the HGVS recommendations.

The sequence was taken from NC_000006.11, covering TNF transcript NM_000594.3.

Please note that introns are available by clicking on the exon numbers above the sequence.

 (upstream sequence)
           .         .         .         .         .                g.5055
      cagacgctccctcagcaaggacagcagaggaccagctaagagggagagaagcaac       c.-121

 .         .         .         .         .         .                g.5115
 tacagaccccccctgaaaacaaccctcagacgccacatcccctgacaagctgccaggcag       c.-61

 .         .         .         .         .         .                g.5175
 gttctcttcctctcacatactgacccacggctccaccctctctcccctggaaaggacacc       c.-1

          .         .         .         .         .         .       g.5235
 ATGAGCACTGAAAGCATGATCCGGGACGTGGAGCTGGCCGAGGAGGCGCTCCCCAAGAAG       c.60
 M  S  T  E  S  M  I  R  D  V  E  L  A  E  E  A  L  P  K  K         p.20

          .         .         .         .         .         .       g.5295
 ACAGGGGGGCCCCAGGGCTCCAGGCGGTGCTTGTTCCTCAGCCTCTTCTCCTTCCTGATC       c.120
 T  G  G  P  Q  G  S  R  R  C  L  F  L  S  L  F  S  F  L  I         p.40

          .         .         .         .         .         .       g.5355
 GTGGCAGGCGCCACCACGCTCTTCTGCCTGCTGCACTTTGGAGTGATCGGCCCCCAGAGG       c.180
 V  A  G  A  T  T  L  F  C  L  L  H  F  G  V  I  G  P  Q  R         p.60

        | 02 .         .         .         .         .   | 03     . g.6208
 GAAGAG | TTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAGGCAGTCA | GATCATCT c.240
 E  E   | F  P  R  D  L  S  L  I  S  P  L  A  Q  A  V  R |   S  S   p.80

          .         .         .         . | 04       .         .    g.6569
 TCTCGAACCCCGAGTGACAAGCCTGTAGCCCATGTTGTAG | CAAACCCTCAAGCTGAGGGG    c.300
 S  R  T  P  S  D  K  P  V  A  H  V  V  A |   N  P  Q  A  E  G      p.100

          .         .         .         .         .         .       g.6629
 CAGCTCCAGTGGCTGAACCGCCGGGCCAATGCCCTCCTGGCCAATGGCGTGGAGCTGAGA       c.360
 Q  L  Q  W  L  N  R  R  A  N  A  L  L  A  N  G  V  E  L  R         p.120

          .         .         .         .         .         .       g.6689
 GATAACCAGCTGGTGGTGCCATCAGAGGGCCTGTACCTCATCTACTCCCAGGTCCTCTTC       c.420
 D  N  Q  L  V  V  P  S  E  G  L  Y  L  I  Y  S  Q  V  L  F         p.140

          .         .         .         .         .         .       g.6749
 AAGGGCCAAGGCTGCCCCTCCACCCATGTGCTCCTCACCCACACCATCAGCCGCATCGCC       c.480
 K  G  Q  G  C  P  S  T  H  V  L  L  T  H  T  I  S  R  I  A         p.160

          .         .         .         .         .         .       g.6809
 GTCTCCTACCAGACCAAGGTCAACCTCCTCTCTGCCATCAAGAGCCCCTGCCAGAGGGAG       c.540
 V  S  Y  Q  T  K  V  N  L  L  S  A  I  K  S  P  C  Q  R  E         p.180

          .         .         .         .         .         .       g.6869
 ACCCCAGAGGGGGCTGAGGCCAAGCCCTGGTATGAGCCCATCTATCTGGGAGGGGTCTTC       c.600
 T  P  E  G  A  E  A  K  P  W  Y  E  P  I  Y  L  G  G  V  F         p.200

          .         .         .         .         .         .       g.6929
 CAGCTGGAGAAGGGTGACCGACTCAGCGCTGAGATCAATCGGCCCGACTATCTCGACTTT       c.660
 Q  L  E  K  G  D  R  L  S  A  E  I  N  R  P  D  Y  L  D  F         p.220

          .         .         .         .                           g.6971
 GCCGAGTCTGGGCAGGTCTACTTTGGGATCATTGCCCTGTGA                         c.702
 A  E  S  G  Q  V  Y  F  G  I  I  A  L  X                           p.233

          .         .         .         .         .         .       g.7031
 ggaggacgaacatccaaccttcccaaacgcctcccctgccccaatccctttattaccccc       c.*60

          .         .         .         .         .         .       g.7091
 tccttcagacaccctcaacctcttctggctcaaaaagagaattgggggcttagggtcgga       c.*120

          .         .         .         .         .         .       g.7151
 acccaagcttagaactttaagcaacaagaccaccacttcgaaacctgggattcaggaatg       c.*180

          .         .         .         .         .         .       g.7211
 tgtggcctgcacagtgaagtgctggcaaccactaagaattcaaactggggcctccagaac       c.*240

          .         .         .         .         .         .       g.7271
 tcactggggcctacagctttgatccctgacatctggaatctggagaccagggagcctttg       c.*300

          .         .         .         .         .         .       g.7331
 gttctggccagaatgctgcaggacttgagaagacctcacctagaaattgacacaagtgga       c.*360

          .         .         .         .         .         .       g.7391
 ccttaggccttcctctctccagatgtttccagacttccttgagacacggagcccagccct       c.*420

          .         .         .         .         .         .       g.7451
 ccccatggagccagctccctctatttatgtttgcacttgtgattatttattatttattta       c.*480

          .         .         .         .         .         .       g.7511
 ttatttatttatttacagatgaatgtatttatttgggagaccggggtatcctgggggacc       c.*540

          .         .         .         .         .         .       g.7571
 caatgtaggagctgccttggctcagacatgttttccgtgaaaacggagctgaacaatagg       c.*600

          .         .         .         .         .         .       g.7631
 ctgttcccatgtagccccctggcctctgtgccttcttttgattatgttttttaaaatatt       c.*660

          .         .         .         .         .         .       g.7691
 tatctgattaagttgtctaaacaatgctgatttggtgaccaactgtcactcattgctgag       c.*720

          .         .         .         .         .         .       g.7751
 cctctgctccccaggggagttgtgtctgtaatcgccctactattcagtggcgagaaataa       c.*780

          .                                                         g.7770
 agtttgcttagaaaagaaa                                                c.*799

 (downstream sequence)

Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10^th nucleotide is indicated by a "." above the sequence. The Tumor necrosis factor protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10^th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift variants, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.